The other day on a web forum it was put to me that humans will most likely evolve to have other senses as well as sight, hearing, smell etc. (this person was coming from a newage perspective, and I think they were implying something about esp/magick).

My argument was something like this: Even though it's theoretically possible for humans to evolve to have another sense, in reality it's unlikely. You have to take into account how evolution works, slight mutations happen randomly and are only retained if they enhance the animal's survival prospects. So for an entirely new sense to evolve, it would have to enhance the competitive edge significantly. Also, if you look at all the complex organisms on earth (some of which have been around for much longer than people, and have had much longer time to evolve), you tend to see more or less the same set of senses. Although some animals have better smell or sight etc than others, generally there isn't a great deal of variation in the senses themself. Maybe if our environment and the way we live changes dramatically this will be reflected in our evolution, but as things stand at the moment, while small mutations might happen over time, the probability of an entirely new sense evolving is not very likely.

I only have a laypersons knowledge of evolution, so I'm not sure if I'm on the right track here. It would really appreciate it if someone with a better understanding of evolution could tell me if my reasoning is correct, or if there's anything else to add to this argument.

Thanks,
Io

Some useful stuff:

http://books.nap.edu/html/creationism/
http://www.atheists.org/bone.pit/
http://www.ucmp.berkeley.edu/history/evolution.html
http://www.evolutionhappens.net/
http://www.talkorigins.org/

What if we, through technology or genetics, enhance ourselves so that we have new senses?

Does that count as evolution? Actually I think it does. But the process would lose its randomness and take on intelligent direction.

Cris

Someday we may find out that the randomness of evolution may not be random....

Growing horns on our head or a tail is possible but is it needed? On the otherhand we may do a genetic change to change our skin color at will (red, yellow, green, blue designs...)

How about changing hair colors through nanotechnology? One tap - redhead, two tap - purple and so on...

I was thinking more along the lines of extending our vision into the infra-red and ultra-viloet, or beyond, and extending our hearing range.

And further out - how about growing wings?

Cris

Increasing the bandwidth of visual and audio spectrum sounds good (like Jodi in startrek) but can we get more information and pleasure out of it that we do not get using manmade tools?

For example, if we increase our hearing to 10 to 100,000 Htz, what does that bring us? The cricket sound at night will drive me crazy.

On the visual side, we definitely would benefit infrared as night vision and UV for bacteria growth and other analytical data.

Originally posted by kmguru
Increasing the bandwidth of visual and audio spectrum sounds good (like Jodi in startrek) but can we get more information and pleasure out of it that we do not get using manmade tools?

For example, if we increase our hearing to 10 to 100,000 Htz, what does that bring us? The cricket sound at night will drive me crazy.

On the visual side, we definitely would benefit infrared as night vision and UV for bacteria growth and other analytical data.

well, I'm afraid you may perhaps discover how many animals actually *communicate*, and how much more efficiently some of them might be doing that...

Raimon

Welcome to sciforums. Nature has a way to pare down inefficiencies...may be that is why we do not have eagle eyes or dof ears. Instead we have a brain and language. As we get too much information, hopefully we may develop high bandwidth organic communication in about 10,000 years or use a computer now....:D

A couple of comments on evolution:

you stated, "So for an entirely new sense to evolve, it would have to enhance the competitive edge significantly." This may be true for humans but even slight selective advantages can sweep through populations. The reason I say it may be true for humans is that even selectively disadvantageous genes are retained in modern human populations due mainly to advances in the medical sciences, and these genes have almost an equal chance of being passed to the next generation. Because selection is relative, a gene conferring increased senses would have no more chance of being passed than the other gene (the one we have now). It may be maintained in a population, but wouldn't sweep through the population.

Also, increases in senses cannot arise de novo. It would probably require large morphological changes probably under the control of multiple genes, that probably don't exist. So, abilities we currently have could be increased, but new sensory abilities are unlikely (we just don't have the raw material to make them).

A more interesting topic in my opinion is an increase in human abilities due to technological and scientific advances. Imagine if we have inherent abilities that we are unaware of, such as mental abilities. Very little is known about the brain's capacity and its potential.

A more interesting topic in my opinion is an increase in human abilities due to technological and scientific advances. Imagine if we have inherent abilities that we are unaware of, such as mental abilities. Very little is known about the brain's capacity and its potential.

That has already happened, but the society is not ready to absorb them. I have two very smart consultants who can very quickly predict pattern in a company performance and design proper infrastructure to access them. Unfortunately, the clients have severe cognitive bias that is based on old methodology and is very difficult to change. It is akin to terms like 'white trash' or 'hillibilly' mentality.

Due to the advancement in science and technology, there is a serious need for multi-discipline people. Yet the trend is to 'silo' the subject to even sub-subjects. Imagine to work on your car, or lawn mower, you need two screw driver experts - one to ununscrew the flat-head screws and the other, philips screw. Let us not even get into the rachets, pliers, drills, and WD40 oiling. You may laugh at this, but that is exactly what is happening in our commercial business sector. Used to, companies look for a subject matter expert on a broad subject such as say, decision support. Now it is divided and subdivided by tools and methodology. Just for report wrting, there are atleast 30 tools that are basically the same. Yet, companies look for a specific expertise on a specific tool in a given city but willing to pay very little. Getting specialized to nth degree has advantages and some serious disadvantages depending on the subject matter. The Enron fiasco happened because, no single individual saw the total picture.

Anyway, we are heading that way, but will take a long time for those advanced properties to benefit the society. That is my personal observation working with Exodus, Global Crossing, Kmart, Stage Stores, Andersen Consulting, Williams Communication, Boston Market (most of them filed for Chap 11).

Originally posted by kmguru


The Enron fiasco happened because, no single individual saw the total picture.



And: isn't that a classic example to illustrate just another major chunk of 'lossed knowledge' throughout the corporate world: i.e. how to 'manage properly'.

Probably based on the trend of growing selfishness, and combined with the overall endless greed, it seems to be forgotten the once unwritten rule that, of course: a large part of the usually huge salaries for managers was supposed to support some or several unofficial 'consulting friends' of such a successful manager.

Nowadays especially the new generation of the so-called 'generic managers' seem to never having heard about that - in fact, and in their often infinite selfconfidence many of them *really* believe to be able to fulfill all aspects of their job just by themselves, being subsequently convinced to be entitled to just cashing in the lot.

Thanks guys, you've given me a lot of things to think about :)

Io

Raimon

Welcome to sciforums. I like your posting here and recommend you start a new thread on the subject in world affairs section.

Originally posted by Io Aurelia

My argument was something like this: Even though it's theoretically possible for humans to evolve to have another sense, in reality it's unlikely. You have to take into account how evolution works, slight mutations happen randomly and are only retained if they enhance the animal's survival prospects. So for an entirely new sense to evolve, it would have to enhance the competitive edge significantly. Also, if you look at all the complex organisms on earth (some of which have been around for much longer than people, and have had much longer time to evolve), you tend to see more or less the same set of senses. Although some animals have better smell or sight etc than others, generally there isn't a great deal of variation in the senses themself. Maybe if our environment and the way we live changes dramatically this will be reflected in our evolution, but as things stand at the moment, while small mutations might happen over time, the probability of an entirely new sense evolving is not very likely.



I disagree. (respectfully)

Here's my understanding of evolution.
Evolution is a pattern.
We can express this pattern Geometrically.

we constuct math models to similate the Evolution of the Earth and to solve complex problems in manufacturing, research and even in Solar System Design.

as humans, the ability to read minds or forsee possible futures would be very beneficial.

IO,
Most evolution models depend on the concept of random mating. This is clearly not true in Humans (when they are sober at least ; ). I can envision people with psychic abilities (or psychological problems), forming an isolated breeding pool with people they understanc/resonate with/form psychic bonds with others and "artificially" selecting for such genes (really groups of genes).

If the human genome does have 36000 genes and there are 2 alleles at each locus then there are 1.2e10837 possible gene combinations. This is way more than the number of people on this planet. Different combinations will give the genetic/biochemical systems different functional characteristics. We don't need mutations to evolve, we already store them in our population as a whole.

Whether or not it's likely to happen is not really subject to scientific analysis at this point, especially in the absence of a purported future sense. In terms of ESP, a lot of information is out there which we filter. As others have pointed out, I'm not sure we need more/better senses to understand the world better (or other people). I think we might just need better brains or better educational techniques to make better use of the ones we have.

Evolution is NOT a "pattern," it's a process. Natural selection is the mechanism by which this process occurs. IO is quite right in identifying the environment as the background on which natural selection occurs, but, a population needs the genetic raw material on which selection can work. For example, humans would need large morphological changes to see into the infra-red range or the Ultra-violet. We don't have the genes for that now (i.e. there are no genes for selection to work upon).

Humans mate fairly randomly, at least as randomly as any other mammalian population.

Scilosopher is right in pointing out that both muatation and recombination are forms of evolution.

There are 2 ways humans can get an ability like mind-reading. Either we have it now but don't know it, therefore, natural selection can't act on it, unless some lucky few develop their abilities; or, the ability arises de novo (see the concept of a hopeful monster). Both are pretty unlikely in my view.

Paulsamuel,
Uhm, nobody I know mates randomly (unless, as stated, when drunk and that usually doesn't result in kids). What is the experimental evidence for that? What is the criteria with respect to which people mate randomly? I certainly think there are a lot of non-genetic factors that go into choice of mate, but it certainly is not random. From a strict statistical/information based analysis if you don't pick the correct criteria a non-random process will seem random. Not to mention the fact that I think mating behavior studies as far as I can remember have evidence for non-random effects in other animals mating (not even limited to mammals).

I'm not sure I agree with the either we have it now or not statement either. There are a lot of abilities that could help sensitize people to very minor mind reading hints. When you know someone well you can put their actions in a lot of context. In such circumstances a leap of intuition working off available information such as body language and other observables could be aided by a bit of esp to reach a conclusion that might be just out of reach otherwise. If that small amount would not be enough to make that qualitative difference in understanding in the absence of those other abilities, it would not possibly be acted on by selection. In that context it could be. All abilities that can be selected on are highly dependent on the others an animal posseses. As long as they make a difference they can be selected on, whether they are used of consciously or not.

Originally posted by paulsamuel
Evolution is NOT a "pattern," it's a process. Natural selection is the mechanism by which this process occurs.

Hmmmm....

Could we not express the process of Evolution as a pattern?

The definition of a process is
(1) : a natural phenomenon marked by gradual changes that lead toward a particular result <the process of growth> (2) : a natural continuing activity or function <such life processes as breathing> b : a series of actions or operations conducing to an end; especially : a continuous operation or treatment especially in manufacture

Originally posted by scilosopher


If the human genome does have 36000 genes and there are 2 alleles at each locus then there are 1.2e10837 possible gene combinations.

I've read that the Genome is almost 40,000 genes.
If we also count the smaller sequence of genes that code for RNA instead of protein it could be even higher.

Eflex,
Current estimates are only going to be order of magnitude. For most genes with no homology, they get the estimate by using genscan a gene prediction program. It joins and splits genes a lot (not because it is poorly written/designed, but due to inherent practical constraints). Anyhow, I was just pointing out that even a conservative estimate of the number of possible combinations is MUCH larger than the population and not well explored.

But you're right - as large as it is it could be much larger. Combine that with environmental differences and things like training we have explored only an itty bitty fraction of the potential of humanity. I don't know personally if I find that reassuring or scary.

I think it's a matter of perspective. If one looks at an individual, it may not appear that mating is random. But when observing an entire population, mating is fairly random. Non-random processes do exist however, for example sexual selection. The effects of these non-random processes on evolution have been extensively studied.

The criterion for random mating in a population is that an individual has an equal chance of mating with another individual (of the opposite sex). This is clearly the ideal and that, in reality, humans don't mate in a purely random fashion. However, it is close to random (I'm looking for some refs. that have shown this). There have been attempts to reveal mechanisms for sexual selection in humans, but none have been satisfactory, AFAIK.

I'm glad you brought up that point concerning abilities. This is exactly what I was thinking of. For example, abilities that we have now (observation based prediction of behavior and motivation); one can envision that individuals could have a refinement of these abilities (either through selection or training) giving them an appearance of mind-reading. If the refined abilities are heritable, then they would be subject to selection, and, if selection was strong enough, they could sweep through a population. OTOH, abilities that we do not currently posess would have to arise de novo.

You're right when you point out that I'm wrong when I imply that unconscious abilities would not be subject to selection. I was thinking specifically about mind-reading. If an individual has an ability, like mind-reading, but that ability is not used, then that ability would not be subject to selection, and the ability would be lost due to drift (think of mole's eyes). That is a more accurate statement about what I was trying to say.

Has anybody tried to create a pig with the smallest set of genes and what was the result? Can a human actually survive with 40,000 genes?

Originally posted by kmguru
Has anybody tried to create a pig with the smallest set of genes and what was the result? Can a human actually survive with 40,000 genes?

Good question

I dont believe in the concept of "junk DNA"

According to a recent article in the Balt. Sun (Feb., 23: pg. 1A), data from the Human Genome Project indicate humans have about 35000 genes. However, "the number of proteins is expected to be more vast - the best scientific guesses put the count in the hundreds of thousands." So, obviously we can live with not just 40000 genes, but with only 35000 genes.

Eflex, "junk DNA" is not a concept, it's a fact of nature, independent of anyone's beliefs.

Paul,
My personal perspective is that most things that appear random just have a bunch of factors where you lack the information to generate a model. Therefore you can't get a good correlation between your data in the absence of that info. Especially when examination at another scale seems to indicate otherwise. The more complicated the mechanisms, the more data you can amass and still not fit it well. I certainly know my interactions with the opposite sex are complicated (often unnecessarily). They might seem pretty random to someone who doesn't know what I'm thinking, but there is a method to my madness.

Regarding the generation of esp, most evolution seems to come from coopting genes to a new function. Maybe certain brain regions can act a bit like an antenna even though they didn't arise for that function. If that weak signal in the background of other senses that give information to the brain can be used to create a more coherent picture ...

On the whole junk DNA thing, there are two observations about higher organisms and their use of DNA that make one wonder if it really is junk 1) DNA serves a structural role in chromosomes - both playing a role in positioning functional elements in chromatin and serving as scaffolding for physical manipulation; 2) The amount of regulatory to coding DNA shows a large increase (though there are ploidy effects - ie gene duplication can moderate this effect).

enjoyable conversation ...

Originally posted by paulsamuel


Eflex, "junk DNA" is not a concept, it's a fact of nature, independent of anyone's beliefs.

I'm not we fully understand DNA to be avle to classify any of it as junk.

Repetition and redundancy is a good possibility for some parts of our DNA.
(A back up copy of critical sequences)

Nature is known for its efficiency and "junk DNA" is a really inefficient concept.

You say "most evolution seems to come from coopting genes to a new function." This is definately true in some cases, but it is certainly not true for most evolution. But, I get your point, and it's a good one, but in the case of ESP or mind reading, there's unlikely to be the raw material in our genes for co-opting to occur.

Concerning junk DNA, I am not saying that all non-coding DNA is junk. I am saying that of the non-coding DNA, some is junk. There's lots of evidence for this. Look at pseudogenes, transposons, microsatellites. Look at the genome of some amphibians where they have genomes hundreds of times the size of humans.

We do understand enough about DNA to be able to explain the source of some non-coding DNA (i.e. mistakes in replication, duplication, genetic drift and the creation of pseudogenes, birth and death of microsatellites, etc.). When this kind of stuff happens, it (the new non-functional DNA) can just hang around. This is the junk. It happens, it's identifiable and it's observable. No big deal. There's nothing "holy" about DNA, where it all has to be functional.

The efficiency of Nature is a misconception shared by many non-biologists. In fact, Nature is inefficient, and there are numerous examples of it. I suggest reading Stephen J. Gould. He loves to point out the inefficiency of Nature as support for evolution.

There is actually no "back-up" DNA. Genes are functional or not. If not functional, they're subject to drift (accumulation of mutation), therefore they cannot back-up anything.

Paul,
Agreed. I meant most new function seems to be due to duplication as the genes present already do something else useful. I've also always wondered if domain structures can also come up from new domains being selected out of the flanking sequence and being tested in moderation by occasional readthrough on stops and such.

Regarding junk, just because something appears by accident or even blatant mistake doesn't mean that it doesn't end up having a functional effect. Usually the function is bad. Occassionally it's good. Having junk lying to around to be selected on (like useless extra copies of a gene) is necessary or changes are going to be contrained from the fact that it is contrained to always effect existing function. Separating natures inefficiency to clear that from its retention of allowing such mistakes because they are beneficial is not a level of resolution I believe we have.

I agree that most is junk right now, but one man's junk can become another man's treasure.

It really doesn't seem likely to me that junk DNA has any future potential. Are you aware of the Mueller's ratchet concept? I am not aware of any evidence that junk DNA has ever become anything useful (or even anything bad). I would happily read anything you have to pass along. Thanks

I am not a DNA expert so I am confused a little bit about the 35,000 number. What it is exactly? Here is the basics as I understand it.

The Basics
Cells are the fundamental working units of every living system. All the instructions needed to direct their activities are contained within the chemical DNA (deoxyribonucleic acid).

DNA from all organisms is made up of the same chemical and physical components. The DNA sequence is the particular side-by-side arrangement of bases along the DNA strand (e.g., ATTCCGGA). This order spells out the exact instructions required to create a particular organism with its own unique traits.

The genome is an organism’s complete set of DNA. Genomes vary widely in size: the smallest known genome for a free-living organism (a bacterium) contains about 600,000 DNA base pairs, while human and mouse genomes have some 3 billion. Except for mature red blood cells, all human cells contain a complete genome.

DNA in the human genome is arranged into 24 distinct chromosomes--physically separate molecules that range in length from about 50 million to 250 million base pairs. A few types of major chromosomal abnormalities, including missing or extra copies or gross breaks and rejoinings (translocations), can be detected by microscopic examination. Most changes in DNA, however, are more subtle and require a closer analysis of the DNA molecule to find perhaps single-base differences.

Each chromosome contains many genes, the basic physical and functional units of heredity. Genes are specific sequences of bases that encode instructions on how to make proteins. Genes comprise only about 2% of the human genome; the remainder consists of noncoding regions, whose functions may include providing chromosomal structural integrity and regulating where, when, and in what quantity proteins are made. The human genome is estimated to contain 30,000 to 40,000 genes.

Although genes get a lot of attention, it’s the proteins that perform most life functions and even make up the majority of cellular structures. Proteins are large, complex molecules made up of smaller subunits called amino acids. Chemical properties that distinguish the 20 different amino acids cause the protein chains to fold up into specific three-dimensional structures that define their particular functions in the cell.

The constellation of all proteins in a cell is called its proteome. Unlike the relatively unchanging genome, the dynamic proteome changes from minute to minute in response to tens of thousands of intra- and extracellular environmental signals. A protein’s chemistry and behavior are specified by the gene sequence and by the number and identities of other proteins made in the same cell at the same time and with which it associates and reacts. Studies to explore protein structure and activities, known as proteomics, will be the focus of much research for decades to come and will help elucidate the molecular basis of health and disease.

So it occurs to me that we have to understand the whole DNA base pairs to create a life form. Is that correct? And knowing just 35,000 genes itself is not enough anymore than having a jet engine without the wings , tail or body to fly? Did I miss something here?

http://www.ornl.gov/hgmis/publicat/primer2001/molecularmachine.jpg

Some other stuff:

By the Numbers

The human genome contains 3164.7 million chemical nucleotide bases (A, C, T, and G).
The average gene consists of 3000 bases, but sizes vary greatly, with the largest known human gene being dystrophin at 2.4 million bases.
The total number of genes is estimated at 30,000 to 40,000, much lower than previous estimates of 80,000 to 140,000 that had been based on extrapolations from gene-rich areas as opposed to a composite of gene-rich and gene-poor areas.
The order of almost all (99.9%) nucleotide bases is exactly the same in all people.
The functions are unknown for more than 50% of discovered genes.
The Wheat from the Chaff
About 2% of the genome encodes instructions for the synthesis of proteins.
Repeated sequences that do not code for proteins (junk DNA) make up at least 50% of the human genome.
Repetitive sequences are thought to have no direct functions, but they shed light on chromosome structure and dynamics. Over time, these repeats reshape the genome by rearranging it, thereby creating entirely new genes or modifying and reshuffling existing genes.
During the past 50 million years, a dramatic decrease seems to have occurred in the rate of accumulation of these repeats.
How It's Arranged
The human genome’s gene-dense “urban centers” are composed predominantly of the DNA building blocks G and C.
In contrast, the gene-poor “deserts” are rich in the DNA building blocks A and T. GC- and AT-rich regions usually can be seen through a microscope as light and dark bands on the chromosomes.
Genes appear to be concentrated in random areas along the genome, with vast expanses of noncoding DNA between.
Stretches of up to 30,000 C and G bases repeating over and over often occur adjacent to gene-rich areas, forming a barrier between the genes and the “junk DNA.” These CpG islands are believed to help regulate gene activity.
Chromosome 1 has the most genes (2968), and the Y chromosome has the fewest (231).
How the Human Genome Compares with Those of Other Organisms
Unlike the human’s seemingly random distribution of gene-rich areas, many other organisms’ genomes are more uniform, with genes evenly spaced throughout.
Humans have on average three times as many kinds of proteins as the fly or worm because of mRNA transcript “alternative splicing” and chemical modifications to the proteins. This process can yield different protein products from the same gene.
Humans share most of the same protein families with worms, flies, and plants, but the number of gene family members has expanded in humans, especially in proteins involved in development and immunity.
The human genome has a much greater portion (50%) of repeat sequences than the mustard weed (11%), the worm (7%), and the fly (3%).
Although humans appear to have stopped accumulating repetitive DNA over 50 million years ago, there seems to be no such decline in rodents. This may account for some of the fundamental differences between hominids and rodents, although estimates of gene numbers are similar in both species. Scientists have proposed many theories to explain evolutionary contrasts between humans and other organisms, including life span, litter sizes, inbreeding, and genetic drift.
Variations and Mutations
Scientists have identified about 1.4 million locations where single-base DNA differences (SNPs, see Goals Box: Sequence Variation) occur in humans. This information promises to revolutionize the processes of finding chromosomal locations for disease-associated sequences and tracing human history.
The ratio of germline (sperm or egg cell) mutations is 2:1 in males vs females. Researchers point to several reasons for the higher mutation rate in the male germline, including the greater number of cell divisions required for sperm formation than for eggs.
Applications, Future Challenges
Deriving meaningful knowledge from the DNA sequence will define research through the coming decades to inform our understanding of biological systems. This enormous task will require the expertise and creativity of tens of thousands of scientists from varied disciplines in both the public and private sectors worldwide.
The draft sequence already is having an impact on finding genes associated with disease. Genes have been pinpointed and associated with numerous diseases and disorders including breast cancer, muscle disease, deafness, and blindness. Additionally, finding the DNA sequences underlying such common diseases as cardiovascular disease, diabetes, arthritis, and cancers is being aided by the human SNP maps generated in the HGP in cooperation with the private sector. These genes and SNPs provide focused targets for the development of effective new therapies.

One of the greatest impacts of having the sequence may well be in enabling an entirely new approach to biological research. In the past, researchers studied one or a few genes at a time. With whole-genome sequences and new automated, high-throughput technologies, they can approach questions systematically and on a grand scale. They can study all the genes in a genome, for example, or all the gene products in a particular tissue or organ or tumor, or how tens of thousands of genes and proteins work together in interconnected networks to orchestrate the chemistry of life.

Originally posted by paulsamuel


The efficiency of Nature is a misconception shared by many non-biologists. In fact, Nature is inefficient, and there are numerous examples of it. I suggest reading Stephen J. Gould. He loves to point out the inefficiency of Nature as support for evolution.


Well

I've studied a little biology in my day...
I'm more of a Biochemist that found his way into Computer Science

1. Nature is capable of becoming more efficient.

2. There are prime examples of the efficeincy of Nature
Water - the H20 molecule is a pretty efficient solute
Hydrogen Bonding
The creation of Hexagonal Bee Honey Combs
The spiral formation of Spiders Webs

3. As electro chemical machines, we humans are pretty efficient at dopamine reuptake at the synaptic level.

Paul,
I don't know Mueller's ratchet, though it sounds vaguely entropic ...

In terms of evidence for pure junk DNA doing stuff, I don't know. The size of regulatory regions seems to suggest there is need for more filler DNA to keep promoter modules from interacting. The usefulness of duplications is seen in the amount in evidence in evolution.

Kmguru,
I'm not sure what you meant exactly, but the number is relavent to estimates of potential complexity in the gene pool as well as the organism itself. Clearly more is necessary for a complete understanding of a person.

Originally posted by paulsamuel
It really doesn't seem likely to me that junk DNA has any future potential. Are you aware of the Mueller's ratchet concept? I am not aware of any evidence that junk DNA has ever become anything useful (or even anything bad). I would happily read anything you have to pass along. Thanks

scientists now generally believe that "junk" DNA must contain some kind of coded information. But the code and its function is yet completely unknown

http://www.psrast.org/junkdna.htm

I find it hard to believe that more than half of our genetic code is Useless

Isn't there a possibility that we dont truly understand the complete function of DNA ?

therefore we are calling pieces of our genetic code "junk" when its actually pretty important?

Wow, what a post!

some notes:

you wrote: "Except for mature red blood cells, all human cells contain a complete genome."
Gametes are haploid, so sperm and eggs can be considered to have an incomplete genome.

you wrote: "DNA in the human genome is arranged into 24 distinct chromosomes"
Actually, although there are 24 distinct human chromosomes, each human cell (except red blood cells and gametes) contains 23 chromosomal pairs (46 chromosomes in all).

you wrote: "So it occurs to me that we have to understand the whole DNA base pairs to create a life form."
We'll need much more than that, but I don't think creating a life form is the goal of science.

you wrote: "The order of almost all (99.9%) nucleotide bases is exactly the same in all people."
I would love to know where you got this factoid. Would you please pass along a ref. for this? Thanks.

you wrote: "During the past 50 million years, a dramatic decrease seems to have occurred in the rate of accumulation of these repeats."
Again, will you please pass along a ref. for this?

Did you just copy and paste the bottom part of this post? If you did, can you supply an URL? Thanks

Originally posted by paulsamuel


There is actually no "back-up" DNA.

ummmmm
maybe "back up" was the wrong word.

Remember, I've been workin' in the Computer Science industry for over 5 years now...

Evolutionarily speaking...

Isnt the whole point of DNA is to have a pristine copy of genetic material avialable for replication.

weren't the first single celled organisms RNA only?

and havent we evolved to store our genetic code as DNA in the nucleus to minimize the damage done by environmental factors such as UV rays, and other forms of radiation?

Paul,

Here is the URL:

http://www.ornl.gov/hgmis/publicat/primer2001/index.html

I don't really want to get into trading examples of efficiency (or lack thereof).

But some comments on your examples:

H2O; really only one way to make it, not a good example of efficiency.

honeycomb; this is a good example of maximizing space, but studies have shown that a circle would be better and that bees use hexagons to come as close to a circle as they can. There are published references on this topic.

The point I was trying to make is that Nature is constrained by the raw material with which it works and that many "solutions" could be considered jury-rigged.

In regards to junk DNA, as I stated earlier, I am not saying that all non-coding DNA is junk, but junk DNA exists (I give examples in a previous post). I take this quote from the web-page you supplied, "The Science article reports on a paper suggesting that the non-coding 97% of the DNA, commonly referred to as junk DNA, might have a function." I believe the 97% is an overestimation, but even if it's not, that leaves 3% junk.

you say, "scientists now generally believe that "junk" DNA must contain some kind of coded information."
I don't believe this. Could you supply a reference? No scientist could mistake coding DNA for junk. But, I agree that not all non-coding DNA is junk. I don't know of any who would say our genetic code is junk. Our genetic code is identifiable by what are called ORF's (open reading frames) which are DNA sequences consisting of triplets (three nucleotides in a row that "code" for an amino acid). Not all of our DNA is coding, this is a well known fact.


In regards to "back-up DNA": during DNA replication, mistakes occur. There are however enzymes that can fix mistakes in replication (and transcription for that matter) but successful repair is not 100%.
The theory is that the first live organisms were RNA based.
It is not universally accepted that the nucleus is membrane bound for protection from the environment, it could be just a mechanism for compartmentilization. A good ref. for why there are membrane bound stuff in eukaryotic cells: Lynn Margulis, and her theories of endosymbiosis.

Muller's ratchet is a hypothesis of irreversible accumulation of deleterious mutations (the analogy being that the ratchet is unidirectional). So, a mutation occurring at a locus would be highly unlikely to fix itself (go back to the original state). When including multiple mutations at multiple loci, it's impossible.

I guess it's analogous to entropy in a way.

Well, I'd like to see some evidence of junk DNA somehow obtaining some functionality, but I don't believe it happens.

Since we know some methods or origins of junk DNA, I think it just accumulates. Is there some mechanism of excising non-functional DNA? If there is what happens to the DNA that is excised? I don't think there are mechanisms for this.

Thanks for the link. Well worth the visit.

Paul,
I'm not sure exactly what the point is with Muller's ratchet. If the point is that a specific coding once lost is difficult to regain, I buy that. The thing is that there are many solutions to the same task so it isn't really necessary to remain the same at the DNA level as long as there is maintenance of the overall organization/function.

Did you mean something more than that? If you did I'm afraid I missed it.

Regarding entropy, I think it is very useful to contemplate life as the transmission and maintenance on information on how to successfully build a good organism. When the information gets modified often the redundancy buffers the problems therein, but in any case from the possible "ideas" encoded about how to succeed as an organism possible solutions are picked. Which is similar to taking a last best solution permuting/modifying it and testing it for success. Very similar to science in many ways ...

It is interesting to note that new information can be generated this way, you can permute and modify the plans for a toaster and get a toaster oven ... just as long as it passes the test of utility it will be maintained. I think of junk DNA a bit like scratch paper myself. You don't want to start scribbling new ideas on the old plans you need.

Originally posted by paulsamuel




you say, "scientists now generally believe that "junk" DNA must contain some kind of coded information."
I don't believe this. Could you supply a reference? No scientist could mistake coding DNA for junk.

Its on the same page that I supplied to you earlier.
(3rd paragraph down)

http://www.psrast.org/junkdna.htm

This page also states

"The idea that a major part of our DNA is "garbage" ignored the fact that a key feature of biological organisms is optimal energy expenditure"

Thus the efficiency debate ensues.

Generally held belief that some of the following parts are unnecessary:

Appendix
Foreskin
Tonsils
Hair

OR are they?

Originally posted by kmguru
Generally held belief that some of the following parts are unnecessary:

Tonsils


OR are they?

Tonsils
The tonsils are mostly composed of lymphoid tissue, which is found thoughout the gastointestinal tract and on the base of the tongue. Lymphoid tissue is composed of lymphocytes...which are mostly involved in antibody production. Since we generally consider antibody production to be a good thing, many studies have been performed to try to clarify the importance of the tonsils. There seems to be no adverse effect on the immune status or health of patients who have had them removed. Any noticable effect has generally been positive. It appears that the tonsils were not "designed" to effectively handle the multitude of viral infections that occur in children in an urban population. Rather, the immune system, including the tonsils and adenoids, developed during a era where the child was rarely exposed to a large number of other people and the germs they carried. It may also be that these organs are relatively more important in dealing with certain types of infections, such as worms or other parasites, that are relatively uncommon in today's society. It is clear that in many cases, the tonsils and/or the adenoids become "dysfunctional" and are more of a liability than an asset.

IMO
I think that as we humans continue to drift away from Agrarian lifestyles and towards CITY life, the tonsils will cease to exist.

Originally posted by kmguru
Generally held belief that some of the following parts are unnecessary:

Appendix



http://www.sciam.com/askexpert/medicine/medicine8.html

Among adult humans, the appendix is now thought to be involved primarily in immune functions. Lymphoid tissue begins to accumulate in the appendix shortly after birth and reaches a peak between the second and third decades of life, decreasing rapidly thereafter and practically disappearing after the age of 60. During the early years of development, however, the appendix has been shown to function as a lymphoid organ, assisting with the maturation of B lymphocytes (one variety of white blood cell) and in the production of the class of antibodies known as immunoglobulin A (IgA) antibodies. Researchers have also shown that the appendix is involved in the production of molecules that help to direct the movement of lymphocytes to various other locations in the body.

Originally posted by kmguru
Generally held belief that some of the following parts are unnecessary:


Foreskin




http://www.nocirc.org/symposia/second/denniston2.html

The facts of penis development demonstrate to us that an unusual process separates the foreskin from the glans in its own good time, covering the infant glans tightly to protect it from fecal contamination; covering the glans to protect it when, while its owner is a child, it is not required for procreation; and finally, freeing up the cover when it is needed for reproduction.

The foreskin covers the elongated shaft of the penis during erection; at other times it protects the sensitive glans penis. The foreskin contains many minute muscle fibers which give it tone. It covers the glans snugly, and helps to prevent the glans from developing a thick, many layered epidermis, which happens in the absence of the foreskin. This thickened epidermis reduces sexual sensitivity

Originally posted by kmguru
Generally held belief that some of the following parts are unnecessary:


Hair



http://animaldiversity.ummz.umich.edu/anat/hair.html

What is the function of hair? In modern mammals, hair serves to insulate, to conceal, to signal, to protect, and to sense the immediate surroundings. Insulation serves to conserve heat, but also, as in the case of diurnal desert animals such as the camel, to protect against excessive heat. The color of most species is probably cryptic, matching the animal's background. In some cases, such as the dramatic stripes of zebras or tigers, cryptic coloration can only be properly evaluated when the animal is seen against its natural background. Many mammals are dark dorsally and relatively pale ventrally, a pattern called countercoloration. This makes sense in the case of aquatic or arboreal species (predators above look down on a dark dorsum, matching the depths or forest floor below, while predators below see the pale venter, against light streaming down from above). Its role is less clear in the case of the many countercolored terrestrial and nocturnal rodents. Hair also provides by its color a means of signaling other members of one's own species (e.g., the white tail of the white-tailed deer, flashed by a fleeing animal to signal danger) or members of other species (e.g., the contrasting pattern of striped skunks, a warning to predators). The pelage also serves to protect the skin from abrasion and from excessive UV radiation. And, through specialized vibrissae, it provides a tactile sense, used, for example, to locate prey or to navigate in total darkness.

Genes may transfer between bacteria strains through plasmid ingestion. Genes may transfer between plants species. (Potential problem with GM crops.) Read of genes injected into blood being incorporated into cells. (Genes were carried in a fatty coating which aided transfer through the cell membrane. Guessing some tranfer would occur even without the coating.) Mosquitoes could presumably act as a vector for gene transmission across animal lines.

This hamster has speculated that a particularly advantageous gene might over time be incorporated into most animal species. Thus only one species need evolve the gene for all species to benefit. Genetic convergence.

The “junk” DNA regions might provide the scratch pad for such beneficial transfers. Some of the “junk” DNA contains old viral DNA.

IH2,
On organisms good gene is another organisms junk. There are drug resistance genes that are only required in organisms with certain other enzymes for instance. Some metabolic genes might be generally useful, but many genes that are useful to one organism might not fit into the scheme of another.

The techniques used to incorporate DNA into cells/organisms include 1) agrobacterium mediated (only in plants - there's this bacteria that causes tumors in plants by injecting it's DNA and using the plant as a factory for the chemicals it needs), 2) electroporation - give the tissue a shock to cause holes in the membrane and naked DNA is taken up, 3) viral vectors - use viruses with the lytic and replicative machinery replaced with the DNA of interest, 4) Naked DNA uptake - usually PEG or polyethylene glycol is used to help get it through the memebrane though the mechanism is unclear (PEG can trap a lot of water which is a hint).

Generally, DNA is highly charged, which makes it not pass through the hydrophobic environment of the cell membrane very well. Many unicellular organisms do take up DNA but the amount increases greatly when they're stressed. This suggests it may require either disruption of membrane integrity or active uptake done as a last ditch attempt to survive. I'm not totally up to date, but I think people have also suggested that the DNA is taken up due to concentration effects - ie stressed cells tend to be surrounded by dead or dying cells which release a lot of DNA into the surounding environment.
Given those as constraints and limitations of the transmission of DNA it certainly occurs, but my understanding is that it occurs most efficiently between unicellular organisms, much less so from unicellular organisms to multicellular, and almost not at all between multicellular organisms.

The muller's ratchet point I was trying to make was that, once DNA becomes non-functional (junk), it's unlikely to re-gain function.

I'm afraid I have no opinion in regards to the analogy of entropy and biology.

I don't think that DNA, once it becomes junk, that it regains function. I guess it's possible, but it seems to me that redundancy is the key to the derivation of new function.

Thanks for the link to the junk DNA site. It's very useful. But, as I stated earlier, my contention is not that all non-coding (doesn't make protein) is junk, it is only that junk DNA exists. I suspect, there will be many examples of non-coding DNA, once thought of as junk, will be found to have function.

Given your responses to examples of purported vestigial anatomical structures, I must ask if it's your contention that all DNA, all morphology is functional?

Scilosopher, thanks for providing some science background for this hamster’s speculation.

Clearly many genes are specialized for a particular species and would provide no benefit to other critters. However there seems to be remarkable conservation of function across animals (even between yeast and man). (Human genes often work fine when use to replace comparable animal genes. The resulting “human” proteins differ from the animal form but seem viable.)

The simple model of speciation seems to be divergence. For asexual reproduction advantageous mutations aren’t shared. For sexual reproduction, advantageous mutations are only shared within a species. This seems highly inefficient given the great similarity across species.

Paulsamuel’s “Muller’s ratchet” does seem to indicate problems with deriving advantageous genes from “junk”. The greater the random walk distance from a useful protein the less likely a useful protein would ever result. (Hamster guess.) Thus there would be a strong algorithmic advantage to starting with “good” genes. (Indeed this is a reason sexual reproduction is so powerful.)

Recombining gene fragments from good genes (both inactive redundant genes and those accidentally incorporated into the human genome by virii) should significantly increase the odds of a favorable protein resulting from a random event. (This hamster has designed successful scheduling algorithms based on this principle.)

This hamster’s intuition is that a “convergent” mechanism (e.g. viral or mosquito transfer of DNA) would confer significant evolutionary advantage over long time periods. Actual transfer of DNA across species might be very rare and yet still provide significant “algorithmic” advantage.

This hamster doesn’t have the breadth or depth of genetics knowledge to evaluate the real world likelihood of this speculation. Greatly appreciate the insight offered by others on this thread.

Do you have a reference for inter-specific gene transfer in plants or animals? I can't think of any instances in which this occurs, although I admit the possibility of a disease organism as a genetic vector between species, however if it occurs, I think it must be rare. But, let's read the literature and see.

We know about mosquitoes as vectors for disease transmission (malaria, etc.) but, although this has been extensively studied (there are literally tens of thousands of references in regards to malaria and mosquitoes), I know of not one instance where it's been shown (or even proposed) that mosquitoes were vectors for interspecific gene transfer. This is probably because the diseases that insect vectors are responsible for transmitting, are species specific.

I understand your point about one species evolvoing a gene in which all species benefit by interspecific gene transfer. However this is not a very realistic scenario, and it's not genetic convergence.

When you say;
"The “junk” DNA regions might provide the scratch pad for such beneficial transfers. Some of the “junk” DNA contains old viral DNA," I assume that you think that "junk" DNA can somehow become coding DNA (make proteins). I don't believe that this can occur. Can you provide some mechanism for this to happen?

IH2,
I think one of the main problems with easy transfer of DNA betweern many organisms is the possibility of such mechanisms being exploited by parasites.

I only said that the junk might me useful for structural and regulatory purposes. The functionally important sequences in these regions are ~10bp and very degenerate in many cases so they can pick up functionality much more easily. Clustered very low affinity sites can work as well so there are many ways to generate a control element. Most such control elements can be oriented upstream, downstream, or even in the introns of genes. Cis regulatory sites that can recruit enzymes which modify histones can also be important in affecting local gene regulation.

Regarding genes I believe duplication and divergence is quite important, and agree that most proteins don't just randomly occur in junk DNA.

Paul,
Without hearing a description of what exactly constitutes junk I think we'll just not communicate efficiently. My reply to IH2 is relevant to this as well.

I would not suggest that non coding DNA in a region of junk is likely to become coding. In fact I said an un-needed copy due to duplication would be available for diverging to a new function.

The main function I proposed it might serve was structural or regulatory. This is more likely due to the mechanisms involved. Still it is more likely the more DNA there is mutating. Therefore since it isn't as big a energetic load for multicellular organisms who maintain most of their cells for longer more is kept around.

Well, I'm glad we agree on some things.

I won't disagree in regards to non-functional DNA becoming functional in a non-coding sense cause I don't know enough about the mechanisms by which this non-coding DNA work.

It would be useful to know the origins of this non-coding, but functional DNA. Any references out there? Seems it could arise by obtaining function by accumulation of random mutations until functionality arises, or evolution by descent (heritibility) or a combination of both. Other questions are, does all junk DNA have an equal chance to become functional? How is it adaptive to maintain junk DNA for some future potential (you cannot evoke group selection)? Are there any phylogenetic analyses of these non-coding but functional regions of DNA (this would show evolution by descent)?

Paul,
I don't disagree with you on a lot of things. It's just when I agree and don't have anything to add I don't say anything.

There have been some promoter studies that have done comparisons of promotor regions of specific genes, but the large scale comparisons are just going to be possible soon due to the sequenceing of briggsae for elegans, mouse for human, and psuedoobscura for melanogaster.

In terms of sites that recruit enzymes which modify histones and such, much less has been done as the sites aren't very well characterized yet and few have been experimentally characterized so it is hard to know what components are required.

One of the main problems with studying this kind of stuff is the density of sequence needed over evolutionary distances. Since it is much more variable, and indeed needs to be so to suit the different organisms uses of genes, you see very little in highly diverged organisms. Also since the functional aspects are poorly understood of these regions and what the necessary rules are for assembling protein complexes on these regions (and often what the complexes even consist of in detail) it gets quite fuzzy.

The basics exist in bacteria and are a little more clear there due to the reduction in coding sequence. There is a paper "The evolution of DNA regulatory regions for proteo-gamma bacteria by interspecies comparisons." by Rajewsky N, Socci ND, Zapotocky M, Siggia ED that does a comparison among 5 bacteria. I think that is probably the best for promoters.

There's also a paper that discusses quite briefly the situation for intron control regions in C elegans "Conservation, regulation, synteny, and introns in a large-scale C. briggsae-C. elegans genomic alignment." by Kent WJ, Zahler AM.

There might be better papers where single genes are compared, but I am not aware of them.

DNA having a structural role is more a common conjecture that makes some sense given the way chromosomes are anchored to the nucleus, space is needed to separate protein complexes assembled on DNA, etc. I don't think anyone has directly studied it, but it is an appealing idea that is consistent with the available data.

Paul,

Mosquito transmission of DNA is wild speculation based on a lab using coated DNA injected into a blood stream in successful gene engineering. Doubt anyone has ever looked into this possibility. Could be very difficult to show. Suspect a first step would be lab experiments to discover the conditions under which naked DNA can be taken up and incorporated into a cell’s DNA.

If cross species DNA transfer does occur, it might well use a mechanism completely unknown at this time. This hamster only provided example mechanisms to show the possibility of such transfers.

This hamster guesses it would be easier to show genes crossing species by direct comparison of genomes than by observing the mechanism of transfer. One would only see the evidence if one were directly looking for the possibility.

As information about the genomes has come to light, this hamster has been surprised at the similarity between animal genomes and the conservation of function across many different animals.

This hamster has wondered why various animal genomes don’t differ more than they do. Common origin and the necessity of preserving critical functionality explain some of the similarity. (Perhaps all of it.) This hamster wonders about other possibilities. (This hamster has also read of bacteria “sharing” immunity to antibiotics and conjectured that similar mechanisms might occur for multi-cellular animals.)

(Also it would be cool if development in one species furthered the development of another. The hamster likes symbiosis and cooperation.)

“I assume that you think that "junk" DNA can somehow become coding DNA (make proteins). I don't believe that this can occur. Can you provide some mechanism for this to happen?”

The easy answer is “nope”. Lots of different stuff in that “junk”. Most of it couldn’t become anything. This hamster recalls some of it being remnants from old viral attacks. In this hamster’s naïve view, “good” DNA might be scattered throughout the junk. A mutation affecting “start” or “stop” codes or a chromosomal copying error might lead to this DNA being transcribed and edited differently, resulting in a new functional protein. The transcription process is far from being fully described. (At least based on the articles announcing new discoveries that appear each month.)

(Part of this hamster’s motivation in pursuing this question is in learning more about the transcription process from the experts on this thread.)

(Paul, this hamster will look for articles discussing DNA transfer across species. Recall articles on bacteria and plants. Only reference to animals was the viral DNA and that is far from transfer of a functional gene. Tend to feel that scientists wouldn’t be so successful in transferring genes between species if nature weren’t already doing it somehow.)

Paul, here’s an excerpt from a site that describes gene transfer among bacteria.

“Bacteria can acquire resistance by getting a copy of a gene encoding an altered protein or an enzyme like beta lactamase from other bacteria, even from those of a different species. There are a number of ways to get a resistance gene:
· During transformation - in this process, akin to bacterial sex, microbes can join together and transfer DNA to each other.
· On a small, circular, extrachromosomal piece of DNA, called a plasmid - one plasmid can encode resistance to many different antibiotics.
· Through a transposon - transposons are "jumping genes," small pieces of DNA that can hop from DNA molecule to DNA molecule. Once in a chromosome or plasmid, they can be integrated stably.
· By scavenging DNA remnants from degraded, dead bacteria.
Unfortunately, if a bacterium gets a resistance gene stuck into its chromosomal DNA or picks one up in a free-floating plasmid, all of its progeny will inherit the gene and the resistance it confers.”

http://www.howstuffworks.com/question561.htm

Paul, here’s a reference to gene transfer in plants.

http://www.ejb.org/content/vol1/issue3/full/1/bip/

“Because of these viral gene insertion events, genetic material from inactive viruses accounts for roughly 3 percent of the human genome. Cullen says that 30-50 copies of HERV-K exist in the human genome, and that some of the copies appear to be active at a low level in normal testicular and placental tissue. The HERV-K genes show even more activity in certain cancers, especially those involving the testes, "but there doesn't seem to be a harmful effect from the activity of these genes," Cullen said.”

http://www.hhmi.org/news/cullen.html

Originally posted by paulsamuel

Given your responses to examples of purported vestigial anatomical structures, I must ask if it's your contention that all DNA, all morphology is functional?

I know it sounds a little hokey.....

But I am a firm believer in the notion, "As above, so below"

If we study a large system like the universe, we can learn a great deal about smaller systems.

If we study small systems like our mitochondria and ATP production, we can learn a great deal about larger systems.

My point is this:
The universe has this unknown substance named "Dark Matter" that accounts for the lions share of mass in our universe.

Astronomers dont fully understand Dark Matter but its importance is undeniable.
Some believe that Dark Matter is the stuff that holds the stars in place via gravity and magnetism....

Conversely,
The Human Genome has 30,000 - 40,000 known genes, the rest is categorized as "junk DNA"

My supposition is that ALL DNA is functional in some way.
The function may be more subtle that simply coding for protein or RNA, but the function IS there.

It appears that promoter regions appear to be too similar phylogenetically in different species to be derived from junk DNA (unless it occured in a common ancester during the origin of eukaryotes). Promoter regions contain highly conserved regions among all eukaryotes, including TATA box and the PRIBNOW box.

When you comment on the divergence of these non-functional regions and the difficulty in phylogenetic comparisons due to this divergence, this is my point exactly. Non-functional areas will mutate freely with no selective constraints, therefore divergence (in a DNA sequence) will occur more rapidly. This is evidence that these regions really are non-functional.

Thanks for the bacteria ref. (although these regulatory regions are not promoters, as promoters are strictly an eukaryotic characteristic). Although I have only read the abstract, it appears that, even in bacteria, these regulatory regions have conservation that indicates common ancestry. This is more evidence that these non-coding regulatory regions are not derived from junk DNA.

Thanks also for the C.elegans ref. These results agree with my own research in intron variation in mammals. Most of the sequence conservation between species is in the 5' and 3' ends of the intron, while the middle part of the introns seem to be free to vary. A quote from the abstract represents my view exactly concerning the identification of regulatory (but non-coding) DNA regions, i.e., "The alignment confirms that patterns of conservation can be useful in identifying regulatory regions and rarely expressed coding regions."

I think it an intriguing hypothesis that non-coding, and apparently non--functional, DNA can have a functional role as spacers for the attachment of scaffolding proteins such as histones. Are there refs. confirming the requirement of such spacers for the protein attachment?

Thanks

You said.
"This hamster guesses it would be easier to show genes crossing species by direct comparison of genomes than by observing the mechanism of transfer."

This is exactly right, and we do it all the time right now when we do phylogenetic comparisons. We would expect, if there were a lot of interspecies genetic transfer, that phylogenies would not be concordant at those genes that were transferred, relative to those genes that are common by descent. In fact, we do see this dis-concordance when examining inter-species hybridization. We have identified viral insertions in genomes using this method. Thus far, we have not seen interspecies genetic transfer via some vector, like a virus, but we have seen insertions of disease organisms' DNA into the host genome.

It is not really surprising to me that fucntional constraints would keep animal genomes similar. It is what one would expect, but in the non-functional areas of the genome, there's lots of difference. I've done some research on intron variation in mammals and the variation in there is quite high, also at degenerate third position bases in codons (both introns and these third positions have a similar rate of substitution).

The mechanisms of bacterial interspecific genetic transfer are unlikely to be applicable in eukaryotes, and there is no evidence, thusfar, that it occurs. There is really no reason to invoke this type of genetic transfer, as all evidence points to commonality by descent, which is the most parsimonious explanation.

One must also remember, in sexually reproducing species, gene transfers have to occur in the gametes for them to be of evolutionarily significance, i.e., heritable (unless one wants to invoke Lamarkian evolution).

Co-evolution is a commonly accepted hypothesis, but difficult to prove, but at least co-speciation has been shown to occur.

I am still not convinced that junk DNA has any potential to become anything more than that.

Thanks for the refs.

The bacteria example is well described and is an excellent example of interspecific gene transfer especially in conferring adaptations to different species. However, these types of transfers can't occur in eukaryotes without some type of vector, like a bactreial or viral disease organism.

The plant ref. is a mechanism for biotechnologists to transfer genes between plant species (agricultural gene therapy). The only natural gene transfer occurs between the disease organism (bacteria) and the host.

Thanks for your reply. You've made your position quite clear (excellent). I personally think that you're opinion is untenable. It's difficult to show that every base pair of DNA is functional, and there's no evidence to support it. But it's quite easy, and has been done, to show that stretches of DNA sequence are not functional and not necessary. But, good luck.

Paul,
I'm glad you liked the refs. I have to really disagree about the similarity of promoters dispelling the evolutionary model under discussion. Anything that becomes functional would typically have many features maintained, but it doesn't explain its origin.

In terms of junk DNA and regulatory regions, bacterial regulation is much more compact and the characterization of regulation in bacteria generally fit with the mechanism discussed, but they have only one cell type and much different evolutionary constraints. I was just giving a paper I knew on synteny mapping, though in this case I can see how it might have been misleading. In context the whole discussion came up through the increase in noncoding DNA in eukaryotes and its possible role. I agree that introns aren't a great example either, but the delineation of regions containing functional elements is one of the reasons it is an early example of more large scale sequence comparisons.

In any organism for a transcription factor to start regulating new genes requires generation of new binding sites. These are the facts:

The binding sites of many transcription factors are quite fuzzy (ie degenerate sequence binding specificity and there is at least one example of a factor that binds two distinct motifs).

Multiple clustered sites is a common feature of many regulatory regions allowing both cooperative binding which allows switch like behavior and in other cases many poor sites to compensate for fewer more exact sites.

These regulatory regions grequently occur in a range of 10kb around the gene and even have intervening genes allowing development of useful regulatory modules over a large range of sequence. There is even a cell death regulation gene called reaper in Drosophila that is 65 aa and has a 100kb regulatory region This requires a certain amount of scaffold and available sequence just to develop.

I never said or thought they wouldn't be conserved, I even directed you to papers that found sequence comparison. But new binding sites have to come from somewhere and the mechanistic constraints of the system are such that it makes a lot of sense. If you also note the increasing amounts of regulatory DNA in higher eukaryotes it would follow that we may have evolved flexible constraints just to allow such increased regulation.

The role of many DNA binding proteins is still misunderstood so there aren't a lot of great refs. Histones are known to be involved in regulating transcription using DNA accessibility which operates through regulated post translational modifications such as acetylation/deacetylaion by histone acetylases (HATs) and deacetylases (HDACs). Methylation and phosphorylation also occur. These effect the superstructure of histone interactions changing the local chromatin structure. Chromosomes are also somehow associated with the nuclear perifery, but the proteins which mediate this are unknown. More may be known about centromere proteins that bind the chromosomes. I know INCENP, aurora B, and survivin are all closely associated with the chromosome in anchoring microtubule assembly during mitosis.

You may be right about similarity of promoters not proving evolution by descent, but the alternative is even more unlikely, although possible. Imagine a random stretch of DNA sequence eventually becoming a regulatory region by random substitutions. I can't believe it myself and believe it to be highly unlikely.

I don't know a lot about the evolution of transcription binding sites, but, to me, it's unlikely that they just arise from junk DNA. I suspect that transcription binding sites coevolve with transcription factors. This is a an easily testable hypothesis. Anyone ever done it?

I fail to see how the facts about transcription factors and their binding sites are evidence that they arose from junk DNA.

Paul, thanks for the info. This hamster was aware of only a few specie genomes being decoded. Hadn’t realized there had been many phylogenetic comparisons.

One difficulty in evaluating data is the data may be fit to the answers the experimenter expects to see. Thus the experimenter may declare that the data shows “A” occurred rather than “B”, not realizing that the data really represented the unknown case “C”. In this case the possibilities were “divergence from common ancestral gene”, “divergence from hybrid gene”, “viral code”, and “unknown”. Would the dis-concordance from the “unknown” case be recognized and reported?

Actually, this hamster doesn’t think the idea of genes crossing species is so wild that some experimenters wouldn’t have considered it. Likely they do look for it and the evidence just isn’t there.

Paul posted: “I am still not convinced that junk DNA has any potential to become anything more than that.”

This hamster agrees that a long segment of random base pairs is extremely unlikely to accidentally code for a useful protein. If junk DNA does somehow contribute to new coding DNA, a mechanism more likely to produce useful proteins would be needed.

Deriving a new gene from an existing redundant gene by a series of simple mutations seems similar to a “greedy” optimization algorithm. These algorithms require that the new solution be better than the old at each step. They tend to find local minimums rather than global best solutions.

This hamster wonders if nature might use several optimization schemes in parallel. Bacteria, plants, and animals all seem to use different mechanisms and face different selection pressures favoring those different mechanisms.

Another question is how rapidly non-functional DNA mutates. The link to viral DNA existing in the human genome indicated that some of the viral code is still expressed in certain tissues. Would seem to indicate the viral DNA isn’t changing very rapidly. Presumably the normal DNA repair mechanisms are repairing that viral DNA.

Paul,
Existing sites most likely do coevolve with the TF. But that doesn't explain where new sites come from. The situation is much different from whether a codin gene could arise by accident where there are much longer stretches of dependencies.

Worst case scenario - an 8 base binding site with equal base probabilities would occur every 1.5E-5 by chance. In a region of 10kb that means the chance of one site occuring is 0.15. That's for an exact sequence for one transcription factor.

Since multiple transcription factors are typically expressed in an overlapping fashion you also get multiple tries.

Figuring for the fact that binding sites are fuzzy ie don't need to be an exact sequence, but just something close the number of possible sequences shoots way up.

Then there is clustering of many weak sites. This has an effect even if they are spread over 150 bp or more.

I just don't see why this is unbelievable. How do you think additional regulatory regions evolve?

Sorry, didn't mean to confuse. You're right, only a few species entire genomes have been sequenced, but one doesn't need the entire genome to do phylogenetic analyses. Literally, tens of thousands of phylogenetic analyses have been published. In fact there are a couple of journals devoted entirely to phylogenetic analyses (Systematic Biology, Molecular Phylogenetics and Evolution)

You can be pretty confident that an experimenter would not be allowed to evaluate the published data in any biased manner. All acceptable biology journals are peer reviewed with a scientific board of editors and outside referees. There are certain assumptions associated with these analyses, though. Dis-cordance would be discovered and reported, and, in fact it has.

Well, genes crossing species is not so wild an idea that it is dismissed outright, and, in fact, as you have pointed out, we know it happens in bacterial species. The problem with eukaryotes, there's no mechanism to test. If we get a proposed mechanism for this type of transfer, we can test it.

Redundant genes are probably the source for new genes. In the complex of genes for histocompatibility, this is accepted.

I don't know anything about "optimization algorithms," but your statement, "tend to find local minimums rather than global best solutions," is what has been theorized by Wright's shifting balance theory. In this theory, one can envision an evolutionary landscape with adaptive peaks. A population reaching an adaptive peak (through evolutionary selective processes) would find it difficult to reach another adaptive peak in the landscape, even though it was higher (more adaptive) because selection would preclude crossing a "valley" to reach the new peak. If you came up with this idea independently, I am extremely impressed with your intellect and intuitiveness. Can't say I would have.

I don't know the different optimization schemes of which you speak, but the evolutionary mechanism of natural selection appears to be at work in bacteria, plants and animals. An alternative mechanism has been proposed in the neutral (or nearly neutral) theory of evolution. It appears that both processes are at work in both eukaryotes and prokaryotes.

We have a good idea about the rate of random mutation and it appears to be universal. The maintainence of the viral gene expression in humans could have a number of explanations which Cullne et al. do not go into in their paper, but there has been much theoretical work on the maintainence of genetic variation. It's important to note however, that, by being incorporated into the human genome, this gene is now on a different evolutionary trajectory defined by human selective constraints.

Ok, well maybe the creation of new regualtory binding sites for TF's is less improbable than I originally thought, and perhaps it occurs, but other regulatory regions are more complex and less likely to arise randomly from junk DNA. Can you propose a way in which to test the theory that junk DNA is the source of these binding sites? Has there been any published work on the origin of these sites? We already have a mechanism for the generation of new genes, duplication and selection. I think that this is the most likely mechanism for the generation for new binding sites, new regulatory regions (promoters and enhancers) and coding genes.

Ultimately, I think it unlikely that junk DNA is an adaptive characteristic as a source for new functions (we're back to the original discussion) because evolution doesn't have foresight.

Paul, this hamster can’t make claims to rediscovering Wright’s “shifting balance theory”. The hamster has been focusing on “optimal” proteins rather than optimal adaptation to an environment. (Though as you note the same algorithmic principle applies to total species adaptation.)

This hamster follows aging research. A hot topic is substances to protect against and repair damage in various tissues. Some critters such as bats seem to have far more effective mechanisms than do mice. A natural question is determining what genes confer that advantage and whether transferring those genes to a mouse would increase its lifespan.

Did bats just get lucky? Did bats experience more selective pressure to “design” a better antioxidant? Is it likely that a human biochemist unconstrained to slight modifications of existing genes could produce a much better antioxidant? If one species got very lucky and “discovered” a very effective gene, would it eventually displace other species? Is there any evidence that this has happened? Is such a possibility remote due to the three billions years of cellular evolution that occurred before the first multi-cellular life appeared? (All the good genes are already taken. Sigh.) These questions seem to relate to the biological mechanisms for generating new protein “solutions”.

There are many ways that “errors” introduce genome changes. (You guys know this stuff far better than the hamster.) Calling those mechanisms “optimizing algorithms” rather than “errors” emphasizes their power to accelerate adaptation. Natural selection weeds good changes from bad.

Even though Scilosopher is focusing on gene regulation and this hamster has been focusing on generation of new structural genes the same optimization issues arise. What biological mechanisms accelerate specie adaptation? (Unlike Scilosopher, hamster speculation isn’t hampered by knowing much biology. Hehe.)

The assumption regarding aging is that longer life is adaptive. This is not a generally accepted hypothesis, human desirability notwithstanding. May I suggest, re: aging, evolution and selective adaptiveness, these books by Sir Peter Medawar, The life science : current ideas of biology, and Induction and intuition in scientific thought.

Paul, this hamster doesn’t assume long life is adaptive. This hamster understands that natural selection is all about maximizing viable offspring. This can lead to longer or shorter lifespan depending on factors such as expected lifespan in the wild. (E.g. possums living on isolated island vs. on a mainland with predators.) Little reason to invest energy in maintaining an animal than has little chance of rearing more than one litter. Also understand redundancy theory as a reason why animals live past child rearing ages.

(Checked out Medawar’s theory on aging. Already familiar with it.)

Traces an invertebrate gene duplicating and taking on new function in vertebrates.

“A field of research has arisen to address what kinds of genetic change over time have occurred in different species to account for so many physical differences despite such genetic similarity. It is called evolutionary development.

"Evo-devo," as Gibson-Brown affectionately refers to this budding discipline, combines the principles of traditional evolutionary and developmental biology in examining the change in gene sequence and regulation that over time lead to the development of new species and eventually new body plans.“

http://www.eurekalert.org/pub_releases/2002-04/wuis-rtg041602.php

Thanks for that link. It was extremely pertinent to our discussion. This ref. should have tons of refs. to other examples of the origins of new functions and morphology arising from genes of differing functions.

Bugs enjoy hamster sex

“Waters's results suggest that bacteria try their luck with mammalian cells all the time. But there is little evidence that such matings are fruitful - reports of bacterial genes transferred directly into the human genome are disputed.”

http://www.nature.com/nsu/011122/011122-4.html

“It now seems that bacteria can mate with any organism with a cell membrane, says Stanley Maloy, a biologist at the University of Illinois, Urbana-Champaign. He says this idea has very profound implications for the debate over the origins of bacterial genes that are present in the human genome but absent in our closest relatives (Science, 8 June, p. 1903): The amount of conjugation Waters detected is high enough to readily explain the possible infiltration of bacterial genes into our DNA, meaning that conjugation could have happened quickly enough to add genes only to humans, in the years since they split from the common ancestor they shared with chimpanzees.”
http://www.academicpress.com/inscight/11192001/grapha.htm

On the other hand…

MORE EXTENSIVE ANALYSIS CASTS DOUBT ON CLAIM OF BACTERIAL GENES IN HUMANS

http://www.tigr.org/new/press_release_5-17-01.shtml

Amazing stuff. Keep it up you chaps.

IH2,
So as a strong supporter of interspecies gene transfer one must wonder who and what your parents were ... the evidence is mounting - just how can a hamster be so smart?

I had heard about bacterial genes being found in the human genome which ended up being contamination by the bacteria they were cloned into. This is always a concern working from unconfirmed sequence. One might also be well advised to PCR genes from human only cells before believing the sequence.

It's cool that someone has shown that mammalian/bacterial cells can "do it", although I would be curious to know what exactly is in the cell culture media ... one can get cells to do a lot of things in culture they won't in vivo.

Paul,
I just noticed I dropped the ball when you asked about a way to test junk DNA for binding site generation. I would take a Drosophila mutant for a gene that reduces fertility and rescue with a working copy that has a purported junk region in front of it (one would also have to make sure that there were no enhancers in the introns).

From there I would do some combination of the following: 1) single fly PCR every n generations on the upstream region and sequence it, 2) wait until the fertility rate has come back up significantly and then test regions upstream of the construct for rescue driving the non-mutant gene in the mutant (or just see if it can drive expression of GFP in the right cell types), 3) use biochemical techniques (methylation interference/gel shift/ DNAse footprinting) to characterize possible binders from those known to be expressed in the right fashion (if they exist - this would also be aided by #2).

A fertility gene should have strong selective pressure on it without much effort. My guess is you would first get less specific expression that rescues the phenotype, but is not necessarily very specific. From there I don't know if it would be selected in a fashion that would permit tracking the "evolution" to specific expression.

While I agree that evolution does not design anything (or have foresight) the possibility that more complex organisms have been selected for molecular processes that encourage the generation of varied morphologies and new function is not farfetched.

Look at somatic hyper mutation and B-cell maturation. While I'm no immunologist and have never gotten the whole thing straight, taking a semi-specific B-cell antibody and evolving it to recognize an antigen more specifically within the life-span of an organism is pretty remarkable. If biology can take advantage of such processes on one scale it may be able to do so on another. Evolution pressure is scale invariant - it doesn't care how things work, just that they do.

You might be interested in reading Mark Ptashne's "Genes and Signals" or "A Genetic Switch". Part of my thinking on this subject matter came from him and he's much more credible and knowledgeable on the subject. Gene and signals especially gets into general issues of protein interactions in evolution and puts forward a model of regulated recruitment. It's pretty interesting stuff.

Admittedly I'm very tired and have skimmed a bit, so smack me if I've overlooked something.

It seems to me that little to no distinction has been made between duplicate genes, introns, and "true" junk DNA; my understanding gained from my coursework was that junk DNA in its most specific sense is huge regions of short, repeating base pair sequences; not unidentified and apparently nonfunctional regions so much as codon gibberish. (Regions that read like CATAGCATAGCATAGCATAGCATAG or the like.) When I went to google to back up this assertion, the vast majority of links I got were to pages associated with new age philosophy, "biotheology", and Creationist sites, none of which I would be willing to cite as a credible source on molecular biology.

Duplicate genes happen often, especially in microrganisms, as duplicating an entire block is a relatively easy and harmless error to make during DNA replication. In a sense they constitute "backup" DNA for a short time, but paulsamuel is right in what they mostly do is sit around being slowly corrupted by genetic drift. Additionally, a mutation to a promoter region can render nonfunctional an entire pathway to slowly corrupt in this manner, if the pathway is no longer strictly necessary. Humans and some other primates share such a corrupted pathway for the biosynthesis of vitamin C; at some point in our evolutionary history we were eating enough fruit that mutations in this pathway no longer had any real consequence. The useless pathway is not exactly junk DNA, as it still codes for potentially functional proteins, but it no longer does anything. Duplicate genes seem to play a very important role in molecular evolution for bacteria. For my last summer job I spent all my time glued to a database of sequenced genomes studying the aromatic acid synthesis pathway of prokaryotes. Several of the catabolic genes of interest had sequences so closely related to other catabolic genes that I had to double-check and weed out the sequence-doubles by hand with every database search for certain genes. In addition, in the enteric bacteria the gene for the beginning of the pathway appeared to have diverged into three different versions that were maintained across species, possibly specific versions for each possible end product. (Tryptophan, tyrosine, and phenylalanine.)

Introns are sequences that are excised from the mRNA before it's sent on to produce the intended protein. No one's quite sure what's going on there, but aside from the "useless crap" theory it's been tentatively hypothesized that it has something to do with the process of protein splicing.

Does that help any?

Cat,
I'm not sure what you're trying to help with. The initial question was about the evolution of new senses. Since then a discussion has formed concerning evolution of new function in DNA.

While I agree that a specific definition of junk DNA would be useful to the discussion I didn't think that junk DNA included introns or duplicated genes. Paulsamuel clearly didn't as he doesn't feel junk can evolve into having function and that was the mechanism he thinks accounts for generating new genes. He also discussed conservation in introns which wouldn't make sense if they are junk. I might have clouded the discussion slightly by accidently implying the papers I referenced on synteny comparisons related to "junk" DNA. I mainly referecned them because they dealt with assessing the function of noncoding DNA which at least overlaps in definition.

Regarding introns alternative splicing is appearing to be very important in higher eukaryotes especially in the nervous system. There are signals in the introns that are used for such purposes. I've had conversations with Chris Burge about them a bit and it was pretty interesting it looks like the paper: A computational analysis of sequence features involved in recognition of short introns. by Lim LP, Burge CB. is the only current publication that might discuss this work. Protein splicing happens too at a much lower rate, but I've never heard anyone suggest that the two are evolutionarily connected. Most hypothesis I've heard involve their role in alternative splicing or domains for recombination to combinatorally shuffle between genes. I've never looked at it myself, but domain boundaries and exon boundaries don't seem to be correlated, so most people don't buy the second. This has always seemed counter-intuitive to me based on the indisputable fact of alternative splicing.

Glad to have you join the conversation though. Your job last year sounds interesting. Feel free to give more details on insights you have gained from specific examples you have looked at.

Paulsamuel,
I came across a paper that relates to the enhancer evolution discussion - have only skimmed it myself but check out: "Evolutionary Dynamics of the Enhancer Region of even-skipped in Drosophila" by MZ Ludwig and M Kreitman. Not online so it might take some efffort to track it down. Basically in populations they find variations in the enhancer region between melanogaster and simulans. They see point substitutions, insertions, and deletions in TF binding sites. They say it is fit best by a model of nuetral molecular evolution. This suggests there are indeed many ways to acheive a functional enhancer element.

Thanks for the ref.

University of Hawaii library happens to have that journal online so I have the .pdf (be happy to email it to anyone who wants it).

There are more recent papers dealing with the same issue if you want more refs.

I haven't had time to do anything except browse the abstracts (new job and all), but it appears that these enhancer regions, which have the TF binding sites embedded in them, are quite long (671 bp in Drosophila) and appear to be, at least on some level, conserved. If so, that would not support a hypothesis of regulatory regions having an origin other than by descent.

paulsamuel,
I'm not sure I agree with that interpretation. While it is clear that they are conserved in some sense once useful, there is more than one cis regulatory module (or enhancer element or whatever) per gene and new ones could certainly be added to pre-existing ones. Indeed to the extent they are modular indicates some utility in regions that can gain and lose expression domains independently.

On the level of individual binding sites it is pretty clear that new ones can be added and old ones lost. So on the most atomic level there is some de novo generation. There is also some regional interpendence of these elements so flanking sites coul be generated in that contest and serve as nucleation for a new module that directs expression in a new cell type. It is certainly also possible for a module to be duplicated and then adapted to directing tissue in a new cell type.

I don't think either mechanism is ruled out in the end. Personally I would imagine their are instances of new modules being generated in both ways. Even if decent is easier and happens more frequently the importance of being able to generate completely new modules may be critical to certain aspects of organismal evolution.

How does one set up a new cell type and populate it with the necessary factors? Even if the initial variants occur by some type of fate separation or descent, supplying new constituents that differentiate the types would require generation of regulatory differences for the non-overlapping subsets. Any factors to be added would need new regions, any factors to be removed would require either repressive modules or at least composition of the current module that will not respond in one of the cell types. It isn't clear to me that descent will always find the factors which would be beneficial and so it would be useful at least to have a mechanism that could.

Your argument was "slight mutations happen randomly and are only retained if they enhance the animal's survival prospects".

My rebuttal: retaining mutations is not dependent upon enhancing the organism's survival prospects.

For example, let's say that one of your mom's gene's mutated and you were born, well, let's just say, not with prom queen looks. :bugeye:

You then have children, and they have children, and somewhere down the line one of your great granddaughters doesn't become prom queen. they have all passed on the new gene, yet it didn't increase or decrease survival. It just made it less fun on prom night.

Any experts on evolution here?

no