Any experts on evolution here?

Admittedly I'm very tired and have skimmed a bit, so smack me if I've overlooked something.

It seems to me that little to no distinction has been made between duplicate genes, introns, and "true" junk DNA; my understanding gained from my coursework was that junk DNA in its most specific sense is huge regions of short, repeating base pair sequences; not unidentified and apparently nonfunctional regions so much as codon gibberish. (Regions that read like CATAGCATAGCATAGCATAGCATAG or the like.) When I went to google to back up this assertion, the vast majority of links I got were to pages associated with new age philosophy, "biotheology", and Creationist sites, none of which I would be willing to cite as a credible source on molecular biology.

Duplicate genes happen often, especially in microrganisms, as duplicating an entire block is a relatively easy and harmless error to make during DNA replication. In a sense they constitute "backup" DNA for a short time, but paulsamuel is right in what they mostly do is sit around being slowly corrupted by genetic drift. Additionally, a mutation to a promoter region can render nonfunctional an entire pathway to slowly corrupt in this manner, if the pathway is no longer strictly necessary. Humans and some other primates share such a corrupted pathway for the biosynthesis of vitamin C; at some point in our evolutionary history we were eating enough fruit that mutations in this pathway no longer had any real consequence. The useless pathway is not exactly junk DNA, as it still codes for potentially functional proteins, but it no longer does anything. Duplicate genes seem to play a very important role in molecular evolution for bacteria. For my last summer job I spent all my time glued to a database of sequenced genomes studying the aromatic acid synthesis pathway of prokaryotes. Several of the catabolic genes of interest had sequences so closely related to other catabolic genes that I had to double-check and weed out the sequence-doubles by hand with every database search for certain genes. In addition, in the enteric bacteria the gene for the beginning of the pathway appeared to have diverged into three different versions that were maintained across species, possibly specific versions for each possible end product. (Tryptophan, tyrosine, and phenylalanine.)

Introns are sequences that are excised from the mRNA before it's sent on to produce the intended protein. No one's quite sure what's going on there, but aside from the "useless crap" theory it's been tentatively hypothesized that it has something to do with the process of protein splicing.

Does that help any?

 

Log in or Sign up to hide all adverts.

Cat,
I'm not sure what you're trying to help with. The initial question was about the evolution of new senses. Since then a discussion has formed concerning evolution of new function in DNA.

While I agree that a specific definition of junk DNA would be useful to the discussion I didn't think that junk DNA included introns or duplicated genes. Paulsamuel clearly didn't as he doesn't feel junk can evolve into having function and that was the mechanism he thinks accounts for generating new genes. He also discussed conservation in introns which wouldn't make sense if they are junk. I might have clouded the discussion slightly by accidently implying the papers I referenced on synteny comparisons related to "junk" DNA. I mainly referecned them because they dealt with assessing the function of noncoding DNA which at least overlaps in definition.

Regarding introns alternative splicing is appearing to be very important in higher eukaryotes especially in the nervous system. There are signals in the introns that are used for such purposes. I've had conversations with Chris Burge about them a bit and it was pretty interesting it looks like the paper: A computational analysis of sequence features involved in recognition of short introns. by Lim LP, Burge CB. is the only current publication that might discuss this work. Protein splicing happens too at a much lower rate, but I've never heard anyone suggest that the two are evolutionarily connected. Most hypothesis I've heard involve their role in alternative splicing or domains for recombination to combinatorally shuffle between genes. I've never looked at it myself, but domain boundaries and exon boundaries don't seem to be correlated, so most people don't buy the second. This has always seemed counter-intuitive to me based on the indisputable fact of alternative splicing.

Glad to have you join the conversation though. Your job last year sounds interesting. Feel free to give more details on insights you have gained from specific examples you have looked at.

Paulsamuel,
I came across a paper that relates to the enhancer evolution discussion - have only skimmed it myself but check out: "Evolutionary Dynamics of the Enhancer Region of even-skipped in Drosophila" by MZ Ludwig and M Kreitman. Not online so it might take some efffort to track it down. Basically in populations they find variations in the enhancer region between melanogaster and simulans. They see point substitutions, insertions, and deletions in TF binding sites. They say it is fit best by a model of nuetral molecular evolution. This suggests there are indeed many ways to acheive a functional enhancer element.

 

Log in or Sign up to hide all adverts.

reply to scilosopher

Thanks for the ref.

University of Hawaii library happens to have that journal online so I have the .pdf (be happy to email it to anyone who wants it).

There are more recent papers dealing with the same issue if you want more refs.

I haven't had time to do anything except browse the abstracts (new job and all), but it appears that these enhancer regions, which have the TF binding sites embedded in them, are quite long (671 bp in Drosophila) and appear to be, at least on some level, conserved. If so, that would not support a hypothesis of regulatory regions having an origin other than by descent.

 

Log in or Sign up to hide all adverts.

paulsamuel,
I'm not sure I agree with that interpretation. While it is clear that they are conserved in some sense once useful, there is more than one cis regulatory module (or enhancer element or whatever) per gene and new ones could certainly be added to pre-existing ones. Indeed to the extent they are modular indicates some utility in regions that can gain and lose expression domains independently.

On the level of individual binding sites it is pretty clear that new ones can be added and old ones lost. So on the most atomic level there is some de novo generation. There is also some regional interpendence of these elements so flanking sites coul be generated in that contest and serve as nucleation for a new module that directs expression in a new cell type. It is certainly also possible for a module to be duplicated and then adapted to directing tissue in a new cell type.

I don't think either mechanism is ruled out in the end. Personally I would imagine their are instances of new modules being generated in both ways. Even if decent is easier and happens more frequently the importance of being able to generate completely new modules may be critical to certain aspects of organismal evolution.

How does one set up a new cell type and populate it with the necessary factors? Even if the initial variants occur by some type of fate separation or descent, supplying new constituents that differentiate the types would require generation of regulatory differences for the non-overlapping subsets. Any factors to be added would need new regions, any factors to be removed would require either repressive modules or at least composition of the current module that will not respond in one of the cell types. It isn't clear to me that descent will always find the factors which would be beneficial and so it would be useful at least to have a mechanism that could.

 

Your argument was "slight mutations happen randomly and are only retained if they enhance the animal's survival prospects".

My rebuttal: retaining mutations is not dependent upon enhancing the organism's survival prospects.

For example, let's say that one of your mom's gene's mutated and you were born, well, let's just say, not with prom queen looks. :bugeye:

You then have children, and they have children, and somewhere down the line one of your great granddaughters doesn't become prom queen. they have all passed on the new gene, yet it didn't increase or decrease survival. It just made it less fun on prom night.

 

Any experts on evolution here?

no