Teach me about DNA/RNA

Discussion in 'Biology & Genetics' started by BenTheMan, Oct 13, 2008.

  1. Saxion Banned Banned

    Messages:
    264
    This is a good thread.
     
  2. Google AdSense Guest Advertisement



    to hide all adverts.
  3. Walter L. Wagner Cosmic Truth Seeker Valued Senior Member

    Messages:
    2,543
    Ben, it sounds from your questions like you could benefit from an introductory biology course. There are lots available on-line, though they should be available at your university as well.

    The pro-karyotes are quite simple in organization. Their DNA is a simple loop, found loose in the cell body. They are very tiny organisms, about 1,000 times smaller in volume than a eu-karyote. They are typically nowadays called bacteria, or the photosynthetic ones are called blue-green algae. The ones nowadays are, of course, descendants of ones that lived hundreds of millions of years ago, before there were any eu-karyotes.

    Over evolutionary time, it is believed that one line of pro-karyotes became more complex, and evolved into a primitive eu-karyote. That primitive eu-karyote had far more DNA, and it became organized into a body we now call a chromosome, rather than just a simple loop structure. The chromosome itself became segregated from the remainder of the cell, by being enclosed in a separate wall-mechanism, and we now call that segregated assembly the 'nucleus' of the eukaryotic cell.

    The more complex arrangement of the DNA also required a more complex reproduction mechanism. The simple loop-arrangement of the pro-karyote's DNA simply split in half, and then had complimentary pairing, producing two loops, thus then allowing the cell body itself to split into two, with each half now having one of the two loops. We call that process 'binary fission'. That's where physicists borrowed the name to talk about the fission of an atomic nucleus.

    The eu-karyote chromosomes are too complex for that simple duplicating process of binary fission. Instead, a more elaborate process evolved that we now call mitosis. This involves a spindle apparatus to pull apart the splitting/duplicating chromosomes, as well as dissolution of the nuclear wall, and reformation of the nucleus wall after they have duplicated/separated. It is a multi-step process, and there are lots of tutorials available on that as well.

    Still later, eu-karyotes developed an even more elaborate mechanism of reproduction, in which the chromosomes not only duplicated, but are split again, forming four sets of chromosomes. This is a 'sexual' process we call meiosis, and starts out like mitosis, but becomes more involved with more steps. A single diploid [two sets of nearly-identical chromosomes] cell will thus divide into four cells, each with a haploid [one set of chromosomes] compliment of chromosomes. That haploid cell, in many organisms, can grow into an adult in the haploid phase, and/or it can fuse with another haploid to form a diploid cell in a process called sexual-union, which in higher organisms we call 'fertilization' [as in the pairing of a sperm and egg].

    That primitive eu-karyote that developed meiosis then became the precursor of a eu-karyote that likely ate [engulfed] a bacteria, but wasn't able to digest it. Instead, the bacteria became symbiotic with the much larger eu-karyote cell, and eventually produced a line of cells in which it was beneficial to the host. Over time, it became part of the cell, and we call that organelle, which evolved from a bacteria, a mitochondria. Evidence of the mitochondria's bacterial ancestry is found in that the mitochondria reproduces on its own within the cell, using loop DNA like a bacteria. It has its own set of ribosomes, and the RNA that make up the ribosome bodies are similar in size and structure to the RNA of bacterial ribosomes, and quite dissimilar to the eukaryote ribosomes in the main body of the eukaryote. That's how we can trace female ancestry, as the sperm cells are too small to contain mitochondria [typically], and consequently higher organisms pass their mitochondria to descendants only from the female side [which egg is huge compared to the sperm, and thus has lots of mitochondria]

    At that stage, the eu-karyote was evolved to the ancestor of all living eu-karyotes.

    Later, another line(s) of eukaryotes ingested photosynthetic blue-green algae, and those lines of eu-karyotes became 'seaweed' (algae), such as diatoms, brown algae, red algae, green algae, etc. It is believed that the green-algae line [not to be confused with the blue-green algae pro-karyotes] later colonized the land, becoming primitive land plants such as liverworts and mosses. In those primitive land plants, the haploid phase of the organism is dominant [the visible photosynthetic portion], and the diploid phase represents only a small portion of the life-cycle. In more advanced land plants, the haploid phase is less dominant, though still present. Conversely, in animals, the diploid phase is dominant, and the haploid phase only exists as the sperm and egg, without growing into multicellular structures like in plants.

    A third major line also evolved, which we now call fungus, or fungi [plural]. In that line, there can be numerous diploid nuclei within the cell. It is also a fascinating study of evolution that leads to the mushrooms [basidiomycetes].

    Good luck with your studies. Just learning what's already known will take quite a bit of study.
     
  4. Google AdSense Guest Advertisement



    to hide all adverts.
  5. Saxion Banned Banned

    Messages:
    264
    Very good thread

    Please Register or Log in to view the hidden image!

     
  6. Google AdSense Guest Advertisement



    to hide all adverts.
  7. BenTheMan Dr. of Physics, Prof. of Love Valued Senior Member

    Messages:
    8,967
    Probably, but my advisor wouldn't spring for it, I'm sure. I do have to finish my PhD sometime soon.
     
  8. Idle Mind What the hell, man? Valued Senior Member

    Messages:
    1,709
    Do you have any other questions, while you're going through some of the resources, Ben?

    Or anyone else, for that matter?
     
  9. S.A.M. uniquely dreadful Valued Senior Member

    Messages:
    72,822
    Perhaps you would care to elaborate on miRNAs and siRNAs enough for him to enjoy the Nature articles?

    Please Register or Log in to view the hidden image!



     
  10. Roman Banned Banned

    Messages:
    11,560
    The general model for DNA/RNA is DNA -> mRNA -> Protein. So transcription is taking what's coded in a DNA molecule and transcribing it into RNA.

    Other than a difference in the ribose (the sugary backbone), RNA uses UTPs in place of TTPs (uracil triphosphate instead of thymine triphosphate), and is much more reactive. It tends to coil up into structures by complementary base pairing with itself. This can both give it enzymatic properties, as well as function as a lock-and-key mechanism, or give it stability. mRNA typically doesn't have these other functions, as it's essentially a letter being sent to the ribosome on what to build.

    Once you get the mRNA (messenger RNA) copied from the DNA, it can be modified by post-transcriptional processes.

    Then the edited mRNA goes to the ribosome, which reads the mRNA and translates it into protein. By reading three bases at a time (3 bases = codon), the ribosome makes one amino acid. So the bases GCU, in that order, code for Alanine. The code is degenerate, so GCC, GCA, and GCG also code for Alanine. In this way, you can get mutations in a genome that don't affect the phenotype or the composition of proteins, since there are multiple codons that code for the same amino acid.

    Everything here has exceptions and is way more complicated. There are dozens and dozens of different controls at each level- transcription, post-transcription, translation, and post-translation that modify the product (what protein is produced). Transcription alone can involve up to a 100 different molecules all coming together to begin copying DNA into RNA.

    But the general model to work with is DNA->mRNA->Protein, where the first arrow is transcription and the second is translation.
     
  11. Walter L. Wagner Cosmic Truth Seeker Valued Senior Member

    Messages:
    2,543
    You should also mention that it is the above property of RNA that allows for it to form ribosomes, which is where the translation takes place, being used as a substrate for the mRNA that migrates there after transcribing the DNA in the nucleus. As mentioned before, the eukaryote ribosome are much larger/different than the prokaryote ribosomes. Both are made of two sub-units, and the eukaryote sub-units are also different than the pro-karyote subunits. Last I checked, their size was measured by the rate at which they separated via centrifuge, in Sv [sverdburg?] units. Perhaps this has been updated more recently.
     
  12. Idle Mind What the hell, man? Valued Senior Member

    Messages:
    1,709
    Baby steps, SAM.
     
  13. BenTheMan Dr. of Physics, Prof. of Love Valued Senior Member

    Messages:
    8,967
    Yes, I am trying to fit in a little study of biology with the rest of my regimen (string theory, supersymmetric field theories, ...).

    I'll be sure and post the most naive questions here

    Please Register or Log in to view the hidden image!

     
  14. BenTheMan Dr. of Physics, Prof. of Love Valued Senior Member

    Messages:
    8,967
    Before I start asking questions, let's be clear---I want to know how this stuff works, not just a series of flash cards about what happens. This is why I failed biology in high school. When people say things like "it curls up", that is fascinating to me.

    What does this mean?

    Reactive with respect to what?

    1.) How does it "coil"? It seems that if it's, say, laying out on my table, it would need some impetus to "coil".
    2.) Given that there are only a finite number of base pairs, it seems to me that large chunks of the strand (I'm assuming it's a strand) look more or less like other large chunks of the strand. Given that the base pairs bind with some strength (van der Waals forces?), and that the strand of RNA itself has some tension, I can imagine a situation where one large chunk of base pairs could be out of place, and the interaction between conjugate bases would be too strong for the tension of the RNA to overcome. Does this happen?
    3.) Given the above, does it coil up the same way every time? What if it coils up wrong?

    So the mRNA is just somehow a copy of the DNA, I guess? What is the mechanism for "copying", and does it happen at regular intervals? If so, how does the "copier" know when to do its job? Behind all of this is some chemical reaction, like some intricate swiss watch made out of carbon, nitrogen and oxygen---is this correct? What makes the whole process go?

    Why would you want to modify it? And what does this even mean?

    I don't understand this at all. Why does it need to be translated? Isn't RNA/DNA a protein anyway? And what does "translated" mean? And how does this "translation" take place? Again, there is a chemical reaction taking place, which means that it is energetically favorable to store information in the protein, right? And if this is the case, why doesn't the protein just copy the DNA directly?

    This tells me that genetic information of less than three base pairs long is irrelevant. That is, if there are three sequences that all give the same amino acid, why do we need three sequences? Given that nature typically doesn't do irrelevant things, why should this be the case?

    This seems unlikely. How do all of these different molecules come in to play? And how does this happen in a finite time---naively there are 100! different ways for these different molecules to float by. So what gives?
     
  15. BenTheMan Dr. of Physics, Prof. of Love Valued Senior Member

    Messages:
    8,967
    Where did the pro-karyotes come from? What is more primitive than them?

    Ehh....ok. I'll take this at face value, but this is pretty dubious. What advantage does having lots of DNA have over having just a little DNA? I mean, usually in evolution we can see manifestly why it's an advantage to, say, have webbed toes vs. non-webbed toes. But what advantage did the primitive eukaryotes gain?

    Again, this seems like an evoutionary disadvantage, rather than an advantage. I know I'm missing something, but I haven't learned how to think like a biologist yet.

    Ahh I see. So mitochondrial DNA is not DNA proper---i.e. it is not associated with the chromosome?

    Eh...It's a long life

    Please Register or Log in to view the hidden image!

     
  16. Vkothii Banned Banned

    Messages:
    3,674
    So, you never peered down a microscope at a drop of water, watched all the little wiggly things?
     
  17. Walter L. Wagner Cosmic Truth Seeker Valued Senior Member

    Messages:
    2,543
    Ben;

    You're beginning to grasp the concepts. Don't think you will be able to learn it via this forum. It will take literally thousands of pages of science textbooks being read before you'll grasp the complexity. From there, you'll be able to 'fill in the blanks' a little easier.

    Yes, the mitochondria have their own separate loop DNA, which they use for their own internal mitochondrial functions. They duplicate like bacteria, i.e. split in two, with their loop DNA also splitting in two.

    You're beginning to grasp some of the complexity of the biochemistry. The DNA cannot directly manufacture proteins. To make a protein, the cell needs a template. The DNA is the template. A copy of the DNA template is made with RNA. That RNA is called messenger-RNA, or mRNA. At the ribosome, the mRNA is 'read' or translated, and the coding sequence is then used to bring in amino acids according to the genetic code, copied from the DNA to the mRNA, and then to the amino acid sequence, allowing for a specific protein to be fabricated.

    However, it is far more complex than just that.

    The DNA has to be 'turned on' or activated to be read. Everything in its proper order. Otherwise, too much of one kind of protein is made.

    Back to your question about prokaryotes. The evolution of the prokaryote into a eukaryote is not well understood. No fossils, of course. Just the modern-day versions, from which we have to infer how it happened. More DNA, of course, implies greater varieties of proteins being made, which implies a healthier cell, able to better compete. Thus, it appears plausible that complexity that favors a healthier cell would be selected for, allowing for development of the eukaryote from the prokaryote. This took billions of years [well, maybe about 2 billion, but someone can correct me if they have a better figure]. However, once that stage had been reached, the stage was then set for multicellular organisms, both plant and animal, that have sex.

    Personally, I find plant sex to be exceptionally fascinating, because it is so much more varied than animal sex. I find that most biologists don't know much about it. As I mentioned before, in sea plants the adult phase can be fully haploid, which can then produce sperm and egg, which can unite to form a diploid phase, which can also grow into a mature adult, which can also produce sperm and egg, though via meiosis. Or, other species can have their adult phase only as diploid.

    In the land plants, there is a distinct progression in complexity of the diploid phase. In the simplest plants [mosses and liverworts], the haploid phase is dominant. The organism forms an archegonium, which has an egg cell develop. Elsewhere [on a neighboring organism], sperm cells develop, which swim through a raindrop into the archegonium and fertilizes the egg. From there, the diploid cycle grows, forming a spore body, which undergoes meiosis, forming four haploid spores. Those are dispersed, and in a moist region they'll start growing into haploid plants. The mosses are quite small [I'm sure you've seen moss]. Liverworts are about the size of a small fingernail, and grow flat on the ground, without root or shoot.

    In more advanced plants like ferns, the haploid phase is present, and forms an archegonium, but when the egg is fertilized, what grows out of it is the fern plant that we see as a much larger structure. On the fern plant, the spores are produced on the undersides of the leaves, and when they fall to the ground, they'll grow into a photosynthetic haploid phase, which looks very much like a liverwort in shape and size. This thus completes that cycle.

    In even more advanced plants, such as Pine trees, the haploid phase is retained on the diploid plant, in structures called cones. There, an archegonium also develops, but the sperm is transferred to it by pollen from other cones, which then grows a pollen-tube through which the sperm swims to the egg waiting for it in the archegonium. The fertilized egg then grows into a baby pine tree, but its growth is stopped shortly thereafter, and the baby pine tree is coated with food and a covering, and we call that a pine seed. They're actually quite tasty; you should try eating baby pine trees if you've not done so previously.

    The flowering plants have the archegonium even more greatly reduced, to where it's just a few cells, not even recognizable as an archegonial structure per se. The pollen drifts [or is transported by bees, birds, or other insects, etc.] to the archegonium/egg-cell region, which is housed in flowers, not cones. There, the pollen grows a pollen tube, but the sperm don't have tails, and they simply 'drift' through the pollen tube, and fertilize the egg, again forming seeds.

    Now Ben, there will be a test on this. I hope you'll be ready.

    And, the above is just a very snyopsized version. But it's good you're taking an interest in the world around you. Most physicists have a hard time grasping the fundamentals, because it is so complex. Instead, they simply work at the simple things, like the LHC, to try to understand the underlying simplicity of it all. But there is no underlying simplicity, is there?

    Regards,

    Walter
     
  18. BenTheMan Dr. of Physics, Prof. of Love Valued Senior Member

    Messages:
    8,967
    Yeah sure, but what do you learn from this? You learn that water has little squiggly things in it, and that they die if you add some salt. You don't learn how they work or where they come from, or how they interact with other little squiggly things that live in your guts. Simple childhood curiosity, a few glass slides and slide covers, and brine shrimp eggs only take you so far.

    So to the very helpful and intelligent biologists, please take no offense to the following

    Please Register or Log in to view the hidden image!



    I took biology in high school and I dissected shit, but all I remember is that there's little fingers in your small intestines called sillia, cheek cells look like grapes, and PGAL has something to do with photosynthesis. No one could tell me how the sillia magically transported the food you ate into your blood stream, or why that should happen. No one could tell me how plants knew how to make PGAL, or why they needed to. No one could tell me why I cared what the inside of a worm looked like, or why I had to memorize all the little organs that I ostensibly destroyed with a scalpel.

    Even the bio classes my roommates took in college seemed more focused on getting them enough basics so that they could pass the MCATs. Consequently, I had a pretty poor opinion of biologists for a long time---microscopes and monkeys, you know. Apologies to the biologists here, I met very few biology majors (as an undergrad) who I thought really had a handle on the field, who were focused on understanding how things worked, versus memorizing enough chemical reactions to get them through the midterm. Eventually this is why I ended up in chemistry, as an undergrad, and now in physics, as a grad student.

    But when I started hearing biophysics seminars and talking to biophysics grad students, I found out that there's actually science going on in biology (imagine that!), and that it was interesting, and that there's tons of stuff that simply isn't known. For example, at the university I'm working at, protein folding is the hot topic---it seems more or less like no one really understands the exact mechanism. They're building attosecond (don't ask me how many zeros behind the decimal that is) cameras to actually watch proteins unfolding and folding.
     
  19. Roman Banned Banned

    Messages:
    11,560
    That is the general way you go from DNA, the "blueprint of life" to the functional stuff like proteins & enzymes. It goes from one sugar backbone with attached nucleosides, to another, to a protein product.

    Many proteins denature when they get too hot or, if pH or salinity changes, the proteins misfold irreversibly. DNA, with the two deoxyribose (a type of sugar) backbones, twists up, protecting the inside bases. This makes it stable at cold and hot temperatures, and a variety of chemical conditions. RNA, on the other hand, since it's not doublestranded (oh man, I forgot to mention that part) and has an extra oxygen that sticking out on it (the D in DNA is for DEOXYribose, as in, ribose without an oxygen). The oxygen adds to the reactivity. Working with RNA is hard, since it degrades much more quickly than DNA.

    RNA, all by itself, as these bases on the inside, which are attracted to each other- A to U, G to C. The letters are short for the bases (as opposed to an acid) that make them up. The coiling puts the RNA into a lower energy state.

    Right. Hydrogen bonding. The same force that hold two DNA strands to make the double helix.

    I am not so familiar with RNA, mostly DNA, but yes, base (mis)pairing can lead to a number of things:

    In DNA, similar matching sequences can slip, forming "bubbles" of DNA. This is a relatively common occurence, and can lead to large repetitive sites, called microsatellites, minisatellites, or Short Tandem Tepeats. The differences are mostly with the size of the repeat, and the number of times it repeats (so a sequence ACGACGACGACG is an STR or microsatellite, while something like AAAAACGGGCAAAAACGGGC repeated 20 times is a minisatellite). These can actually cause disease, usually forms of mental retardation, such as Fragile X syndrome. But this is all at the DNA level, and actually have to be transcribed into RNA to cause problems (in most cases, there are always exceptions!).

    Most of these STRs are silent- that is, they don't affect phenotype as far as we know. However, some STR sites can very tremendously from individual- DNA fingerprinting used in CSI looks at about 15 of these sites, I believe.

    As for ribosomal RNA, the RNA that makes up part of the ribosome, the way the RNA coils is important to give it the right structure for ribosomes.

    Given the same environmental conditions, it should. Of course, other parts of the body can be producing proteins or hormones that will interfere with the mRNA, and target it for degradation by sticking to it, for instance. This might be done if the body no longer needs that mRNA, and it being translated would cause problems or be costly (like translating heat shock proteins when the organism gets cold).

    Bad things. Some mRNAs may not be able to be read (translated), and produce non-function or poorly functioning proteins. Ribosomes will not be able to translate, effectively turning off the cell's protein factories. Transfer RNAs, or tRNA (haven't gone over this one yet), may move the wrong amino acids when reading mRNAs. A tRNA is a loop of base-pairing RNA with an amino acid attached. The complementary matches mRNA on a ribosome, and sticks the amino acid onto a growing chain of amino acids. More on tRNA later.

    Essentially. One base, the T on DNA, is replaced with U when transcribed to RNA. Ribose, the R of RNA, is a five carbon ring identical to Deoxyribose, D of DNA, except that there is an OH group on the 2' ring carbon. This means RNA, with an additional functional group, is more reactive than DNA. This leads to its ability to form structures (an important one being the tRNAs), as well as giving RNA to fold up and cleave itself.

    It's complicated. I will address this in a separate post, when I have more time.

    I've mentioned how RNA is reactive. mRNA is no exception. In order for it to make it to the ribosome unmolested, it needs a 5'cap, which is composed of methylguanine, I think. Basically the head gets a protective bit that contains some directory information, as well as poly-adenylation- the addition of more A's a the end, or tail of the molecule. The longer the tail, the longer it takes to degrade, since all the A's have to degrade first.

    mRNA can also be edited after transcription, whether because of other concurrent events in the environment, or simply because that's how it works, or because we don't know yet. In some cases, imagine ordering a bunch of gizmos for your lab, but upon writing a long letter, you realize you need the more specific gizmotron. So you simply go back and add -tron to all your gizmos in the letter.

    Well, transcription (will have another post on it later) is the act of taking a strand of DNA (usually double stranded) and making an mRNA copy of it (usually single stranded). So post-transcription modification is stuff that occurs after transcription occurs- after you finished writing your letter ordering more gizmos. Both the 5'cap and addition of the poly-A tail can occur, and do occur, during transcription. They're not entirely post-transcriptional activities (though the poly adenylation mostly is).

    DNA and RNA are simply sugar molecules carrying information in the form of nitrogenous bases. They are used by the ribosome to construct the building blocks of life: protein, from the... building blocks of proteins, amino acids. DNA & RNA are most definitely NOT proteins. Think of them as documents, if you anthropomorphizing the concept helps. A document can only describe. On it's own, you can' build a skyscraper from pictures. You need steel and men and machines.

    The "reading" of mRNA by the ribosome, the transfer of amino acids by tRNAs based on what the sequence of mRNA specifies, and the construction of the protein. So it's taking our blueprint for the skyscraper and building it.


    I don't know as much about translation. I'll try to tackle it in another post, if someone doesn't get to it first.

    Right.

    Presumably because the reaction is only possible with the intermediate step (given biological conditions). Many, many, many organic syntheses require many, many, many intermediate steps to assemble the correct molecule without losing the side chains and R groups we want, while still keeping it cheap, or possible for that matter.

    The genetic material of organisms is mysterious stuff. We eukaryotes seem to have many redundant processes and a lot of "junk" DNA. DNA that we have no idea why it's there, and appears to do nothing. Though if you want an evolutionary explanation, it means that the 1 mutation per 1,000,000 bases rate (that is, in your genome, expect one mutation for every sequence of a million bases), few of them are actually going to change anything. Our longest chromosome has 226 million bases. We have 46 chromosomes. As you can see, we have a lot of errors.

    No one really knows. It's a big mystery in molecular genetic. It seems EXTREMELY unlikely.
     
  20. Walter L. Wagner Cosmic Truth Seeker Valued Senior Member

    Messages:
    2,543
    And Ben, aren't you glad that it all works properly without you having to understand how it works? Amazingly complex. Not something we want to jeopardize.
     
  21. CharonZ Registered Senior Member

    Messages:
    786
    Without really wanting to break up the fun I have to mention that while not really wrong (at least just from speed reading it) there is some confusion in the above posts regarding certain concepts. It is especially worthwhile to note that certain things mentioned only apply to eukaryotic cells, but not to prokaryotic. Learning just based on random posts will result in flash-card knowledge. If you are really interested you really should take a peek into textbooks and then maybe ask specific questions.


    It really might be more worthwhile to grab a textbook for starters rather than trying to make sense out of posts in a forum. The reason being that the topic is rather complex (if not complicated) and posts with a certain skewed focus might actually contribute more to confusion than clearing things up, in my opinion.

    But to another point, high-school biology generally does a very poor job to introduce biology, and even undergrad studies often have a hard time. The reason being that biology is extremely complex, I daresay one of the most, if not the most complex natural science. This unfortunately results in the fact that most students memorize rather than understand, because the matter is just bloody complicated and you need knowledge from different disciplines to actually be able to get a rough idea of something that is going on. Physics with its (generally better) defined systems is much easier to grasp and convey.

    Another result is that physicists, even from very different disciplines, have an easier time to communicate rather than two biologists even if both deal with living matter (put a ethologist and a genomics guy into a room and see what happens).
    I have worked in recent years with biophysicists and I found their approach interesting, though usually they (naturally) focus on certain minute interactions, while disregarding much of the complexity of what is actually happening. This makes sense, of course, because otherwise you are not able to do proper calculations. On the other hand, many (especially grad student level and below), then get idea that what they do is "proper" biology, that is that they are able to figure out a cell based on these minute interactions (as these are the basics of the cell after all). We biologists are often seen as spoilsports as we then raise the bar and say why it works different in nature (as opposed in a simple system under the AFM, for example). Much like knowing the alphabet does not enable one to understand English (or Shakespeare). On the other hand, biology training is often abysmal when it comes down to spelling (maths).
     
  22. BenTheMan Dr. of Physics, Prof. of Love Valued Senior Member

    Messages:
    8,967
    Heh... Tell that to my undergrad students.

    Are there any free online textbooks, or do I have to go digging around a used book store?

    Or, is there a book like "Biology in a Nutshell".
     
  23. CharonZ Registered Senior Member

    Messages:
    786
    Well my undergrads generally only memorize...

    Please Register or Log in to view the hidden image!



    There might be online sources around, though I never used them and as such cannot make any assessment regarding their quality.

    Also biology being so diverse there are few (if any books) that (unlike physics books) give a good overview. The only book that I know that tries to give some basic biology in some breadth (in acceptable quality) is "Biology" (Campbell).
    During my undergrad time I essentially found far more good physics books than biology ones. That was one of the reason why I really wanted to become a biologist rather than a physicist (go figure).

    If it is genetics that is of interest to you I can recommend "Gene" from Lewin. Also "Molecular Biology of the cell" from Alberts might be of interest.
     

Share This Page