A Morpholino antisense drug has been approved by the US FDA. http://www.fda.gov/NewsEvents/Newsroom/PressAnnouncements/ucm521263.htm This drug binds to complementary RNA to change biology, in this case altering the splicing of the protein that, when mutated, can cause Duchenne muscular dystrophy (DMD). Frameshift mutations cause DMD; antisense oligo can often restore the downstream reading frame by causing the spliceosome to excise exons which put the reading frame back in-phase. This is background on Morpholinos. https://en.wikipedia.org/wiki/Morpholino Here are some notes about the drug. Eteplirsen (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488) Morpholino phosphorodiamidate antisense oligomer CTCCAACATCAAGGAAGATGGCATTTCTAG 20-mer 20% G 43% CG Predicted Tm: 88.9°C at 10 µM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
