That is the argument of "irreducible complexity", which is a favorite of proponents of Intelligent Design, as exemplified by Behe. The argument has been refuted many times in many different places. There is no convincing evidence that any living system is, in fact, irreducibly complex to the extent where it could not have arisen via evolution, despite IDers claims to the contrary.
Addendum: Perhaps you have heard the argument about a mousetrap being irreducibly complex? Is it argued that if you leave out just one of the working parts of the mousetrap, such as the spring, the trapping bar, the baseplate, or whatever, the mousetrap could not possibly do its job. Therefore, it stands to reason that the only way a mousetrap could have come about is by intelligent design. There's no way it could evolve. This is a commonly used analogy for biological systems. The fault lies in the assumption that just because Behe or some other author cannot personally imagine how a mousetrap with fewer or simpler working parts could possibly work, that such a thing is impossible. Far from it. Similarly, just because you personally can't imagine how certain arrangements of DNA might have evolved from simpler versions doesn't mean it never happened. For a great illustration of all this, see here: A reducibly complex mousetrap
Well, actually, nature wouldnt go so far out of the way to make a mechanical mouse trap. Ever hear of a coffee can with a bit of paper over it? What about a hole in the ground, a rodent falls in, and can't get out. But then, God must have had to dig the hole. Not.
You have not addressed the issues I raised. You label me as something I am not then proceed to dismiss my arguments simply by stating they have been refuted many times. Again; this is your opinion. Others disagree. If you want people to believe you then present your argument and provide the supporting evidence. No I had not heard of the mousetrap argument but I checked out the reference you gave. It is true that the progress of science is sometimes inhibited by those who can not imagine what is possible. But you need to provide evidence for your case and from what I read about the mouse trap I am far from convinced. Your article seemed to be making two points. 1. That it could function without all of its parts; (it is not irreducibly complex). 2. That a mouse trap could evolve without being designed; (no intelligent designer). Irreducible complexity: The article seems to be saying that a spring placed over a mouse hole would somehow contract for no reason when the mouse appeared. This is meant to demonstrate that the spring alone could be an effective mouse trap. But to make it more efficient it gets wound around a hammer and stapled onto a board by a designer that does not exist. In the next drawing we have a hold down bar that is not secured at one end. This does not matter though because the hammer that is not held by anything is miraculously released to catch the mouse at the appropriate time. Again we are meant to believe the mouse trap will work without all of its parts. Presumably we are meant to believe this because we have animated drawings showing how it works. But it would not work. I found this article absurd. It is trying to argue against irreducible complexity and has failed to make the case. More importantly though it has failed when using a mouse trap. A mouse trap is an extremely simple design and should be more easily reducible than complex living systems. No intelligent designer: I am not sure what the point the article was making but it seemed to suggest that the various parts of a mouse trap might fall together accidentally. We are left wondering however how the various parts might have come into existence. Not only do we have a conveniently shaped spring, hammer and hold down bar but we also have staples that get nailed into the support board in exactly the correct place. And how did the design evolve? Did all those less efficient mouse traps get replaced by more complex mouse traps by some process of natural selection? I am wondering if anyone is suggesting that a mouse trap might have actually evolved this way? Obviously not because the idea is preposterous. No non living complex system has ever been designed this way. All non living systems that are complex and perform a function have been designed. But we are told that living systems (the most complex of all systems) have no designer. This is illogical and the scientific establishment should have the good sense and fortitude to admit that life could not have evolved this way.
Robert_js: You did raise the issue. See my quote of your post. And I did not simply dismiss your argument out of hand. I gave you an example which I hoped might be helpful to your thinking. Yes, it is my opinion. That goes without saying. And yes, others disagree, but on the whole they are not people who deserve to be taken seriously. The majority of arguments I have seen on this issue have been misguided, and often ill-informed as well. As far as onus of proof is concerned, it is traditionally on the claimant. IDers assert that irreducibly complex systems exist. I say: show me some examples. It is not up to me to prove that no such systems exist. Actually, the article was concerned only with point 1, I think, and not point 2. A mousetrap does not reproduce itself with variations, so it could not evolve by itself. The article was a specific refutation of the claim that a mousetrap is irreducibly complex. Why bother refuting that particular example? Because it has been held up by IDers as a valid analogy to various living systems. No. The ends of the spring are propped against each other, and are triggered by the mouse dislodging the ends from each other. Yes. Not as effective as a standard trap, but it could still catch mice. Analogy to a living example: a light-sensitive spot is not as good as a compound eye, but it is still better than nothing in terms of seeing. The relevant part of the example is not the details of construction, but the fact that a simple "design" can be gradually made more complex by small modifications. (See the analogy with living things?) It is not important to the example that a human being is needed to actually build a mousetrap, while a human is not needed to build an eye, for example. Beware of pushing an analogy too far. It is not meant to literally reproduce all features of evolution - just the particular feature under discussion (complexity from simplicity). Again, you haven't looked at the diagram and explanation carefully enough. I suggest you take another look, rather than have me explain it to you. The bar is released by the mouse knocking it. It is no miracle. And it is held down at both ends. Why wouldn't it work? Show me where it has failed. No, that was not the point. Maybe, maybe not. We don't have access to the original mousetrap designs, do we? We don't know whether some kind of simple mousetrap was invented first and then improved, or whether the modern mousetrap is essentially the same as old mousetraps. At a guess, I'd say the modern mousetrap is an improvement over mousetraps which existed 100 years ago, in many small ways. As I said, you have to be careful about pushing an analogy too far. Mousetraps do not reproduce themselves or build their own parts; nobody is arguing that here. Was the Grand Canyon designed? It performs the function of carrying the Colorado river, and I don't think anybody would argue that it isn't complex. What about sharp stones used as tools by early humans? Were they designed? See? You are an IDer, even though you deny it.
This from a person who thinks his computer has a consciousness!!! First let me say that I object in the strongest possible way to being labelled An IDer. I do not even know what an IDer is. And presumably neither do you. Sometimes you refer to an IDer as someone who believes in irreducible complexity and on other occasions as people who do not believe that life could have evolved without intelligent design. I believe in the latter but before yesterday I had never contemplated the subject of irreducible complexity and have no opinion on the matter. But your determination to label me is objectionable. I have my own views which I am happy to put forward and do not wish them to be associated with the opinions of other groups or individuals with whom I may disagree. On the matter of IDer (intelligent design), irreducible complexity and the mouse trap analogy I would like to clarify some issues. First is that I have had another look at it (as you suggested I should) and I may have to correct some points I made in my last post. On reading the diagram explanations (first 2 diagrams) I concede that the point was made that the ends of the spring needed to be tripped by the mouse. (Actually the first diagram does not have them touching and in the second diagram they overlap.) And later I argued that one end of the ends of the hold down catch was not secured at one end when it was actually tucked under the end of the hammer. Like my correction on the “Out of Africa” theory I am happy to admit where I get it wrong. So what does this mean on how I view the argument on irreducible complexity. Well that depends on what the argument is claiming. 1. Is it being argued that all designs can trace their function back to the simplest possible state (i.e. even the spring can catch the mouse without the other parts of the mouse trap.)? 2. Is it being argued that all complex design can be traced back to the most simple state? What if by reducing the design to the most simple state the function of the simple design has no relationship to the function of the more evolved (complex) design? 3. Is it being argued that all complex systems (man made or living) have been designed by an intelligent designer? Points one and two I do not really have an opinion about and nor do I think they are important. Point three I agree with. You say; “See the analogy with living things?” But in the very next sentence you dismiss the analogy with living things; (i.e. “It is not important to the example that a human being is needed to actually build a mousetrap, while a human is not needed to build an eye, for example.” How can you be drawing the analogy between a mouse trap and living things and then be saying; sure the simple one has a designer but the far more complex systems do not have a designer. If we do not know how the mouse trap was designed (and we do not know how living systems were designed) then your qualified analogy is worthless. I do not agree that the Grand Canyon is a complex design. I have been to the Grand Canyon and I do agree it is an awe inspiring sight and one that truly reflects the marvels of nature. I would also agree that there are many complex living systems that form part of the natural environment of the Grand Canyon and the Colorado River. But the path the Colorado River took (and the cutting out of the Grand Canyon) is not an example of intelligent design; merely the force of gravity pushing the water through the point of least resistance on its way to the sea. A knife is an example of how some designs are reducibly complex and how a more complex design may have evolved from something far more simple. But it is equally obvious that the modern knife benefited from man’s ingenuity and is the result of intelligent design; primarily in the development of hard metals that can be sharpened and will hold their edge for longer. You will not however push the mouse trap analogy (irreducible complexity) to include the intelligent design of living systems. So I can not see how your argument against irreducible complexity supports your claim that living systems have no designer. Your claim that living systems have no designer is still just a claim. The onus of proof is on you.
Robert_js: We can have that conversation elsewhere if you're really interested, but it's off-topic for this thread, I think. An IDer is any person who believes that all life on Earth was designed by an "intelligent designer". IDers are distinguished from Creationists mostly in that they are careful not to mention the "G" word when they talk about the postulated "designer". Most of the time, I find that these things go hand in hand with these people. I find that a little odd, since I stepped into this discussion following a comment you made on that very issue. I'm fairly confident that, if you find out more about their views, you will find them to be quite compatible with your ideas. But don't worry - I am happy to take your views at face value. I will try not to prejudge you just because you seem to share a common outlook with certain other people. No. That issue is addressed in the link I provided. In the later steps of developing the mousetrap you will notice that some elements, which at one time were "optional extras" not essential to the workings of the trap, became indispensible - without them the trap would not work any more. The analogy in this case shows that features of living things which would seem to be useless without a range of other supporting features might nevertheless have arisen independently. Their original function may have changed since they arose by chance. To take a real-world example, it is thought that certain dinosaurs developed feathers for warmth. Over many generations, these we co-opted for flight, and thus we have birds today. No. The argument is making a specific analogy and addressing one point in the debate - that of irreducible complexity. It is not supposed to be a general argument against intelligent design, and to read it as such is to push the analogy way too far. The example, as I keep pointing out, makes a point about irreducible complexity only. It also serves as a warning - just because you, personally, cannot see how a particular complex feature of a living thing may have evolved from a "simpler" predecessor doesn't mean it could not have happened. Equally, then, could I not argue that a living thing, say a human being, is not an example of intelligent design? It was put together by the "forces" of biology, chemistry and physics, just like the Grand Canyon. The fact that man had to work to improve the knife is a function of knives being inanimate objects, unable to reproduce themselves and therefore unable to produce their own variation. Again, beware of pushing the analogy too far. It doesn't. What it does show is that assuming that a system is irreducibly complex, and therefore intelligently designed, is a dangerous assumption to make. Why? Because it is an assumption. I am interested in why you think the default position is that a designer exists? Would it not be easier to assume no designer a priori, and then look for possible evidence to the contrary?
John Connellan I do not think you got my point here: If it is argued that our universe is necessary for time and probability then there are parameters (the start and finish of our universe) within which time and probability can exist. Or to put it another way; time and probability can only exist within our universe. So what happens if our universe (in another 20 billion years) disappears into a big crunch? Then there is no time and no probability. Then there is nothing. We exist now but will we have ever existed after the universe no longer exists? This is obviously a ludicrous argument. But I believe it is important to address it because Physicists like Paul Davies argue that before the universe there was no time and therefore nothing created the universe. Again I stress that this is a cop out argument and its only purpose is to remove the argument from rational debate. So I am merely stressing the point that if time is a function of matter, and it did not exist before the universe, then it will not exist after the universe. So Paul Davies and his supporters (if they want to pursue this ridiculous line of argument to its logical conclusion) can try explaining how sometime in the future we will have never existed. I believe the probability of life being created without a designer (and a purpose) is just as improbable as the universe having come into existence without a creator. But even if you are correct then this does not explain the existence of the universe. And without the universe there is no life.
Dinosaur I agree with all of this but this is not what I am arguing. I do not know what the limit of complex man made devices might ultimately be and it may well be that someday they can mimic human intelligence. But if this happens it will be because they have been designed. My argument is merely that complex systems can not come into existence without being designed. And life on earth is far more complex than any intelligent system we currently have (or are likely to have in the foreseeable future) but most of the scientific community will argue emphatically that complex living systems were not designed. I am not a mathematician but I did not think it was necessary to give a context here. My example allowed for any non-random sequence of four digit numbers. I wanted to know the probability of any set of 70; four digit numbers falling into place in a non random sequence. My purpose in finding any non random sequence is to head off the objection that; “it did not have to be that form of life it could have been any thing that worked”. So the exercise I presented allowed for anything that is non random. I allowed for anything that was non random having the possibility of getting life started even if (as would most likely be the case) it made no sense and had zero chance of coding for any workable system. In regard to the other points you addressed to anybody -: I have no problem with evolution. My only contention is with the Darwinian argument that natural selection could drive the design of complex species. Yes the fossil record of the horse is the favourite of Darwinists because it is one of the few almost complete fossil records. But most other species (including our own) have proven very good at hiding the bones that would reveal a detailed and gradualist evolutionary process. This is why world renown palaeontologists Stephen J. Gould (and many others) gave up on the fossil record and came up with the P.E. (punctuated equilibrium) theory. There are no environmental conditions that would drive the evolution of greater complexity. Single cell organisms are by far the best adapted at all environments. And they are far more able to adapt to change whenever the environment changes. This is why more than 99% of all species that have evolved past the single cell organism have gone extinct. Evolving greater complexity has always been (and will always be) a disastrous survival strategy. Single cell organisms survived unaided on the moon for 30 months. They can survive flash heating to 1,500 decrees Celsius. They can survive being frozen. They have been found six miles underground in high pressure thermostatic vaults metabolising rocks. They can live in acid baths. Basically the only thing essential for the life of single cell organisms is water. Survival has not driven the evolution of greater complexity. This is why I have argued there is a purpose for the evolution of greater complexity. I have put forward the theory that we evolved greater complexity so that a species (our own) would develop the capability of hosting our human consciousness. My model holds that our consciousness is the reproductive cell of our parent species on the next higher level of the multiverse. For more information download my book for free at www.godgametes.com I realise my model sounds a little loopy but Darwinian natural selection is plainly wrong. I would be much more happy to be debating the merits (and possible flaws) of my concept than spending countless hours trying to knock over Darwinism. But the scientific establishment a hell bent on defending this 150 year old bankrupt theory and I have not got past first base with the God Gametes model.
Robert JS: You continue to make positive statements as though they are facts when they are only your opinion. Claiming that natural selection is plainly wrong and/or bankrupt is outrageous. Perhaps it is wrong, but I find it hard to imagine that it is far off the mark. It is not plainly wrong. If it were plainly (obviously) wrong, there would be some mainstream scientists presenting cogent arguments against it and describing an alternative theory with supporting evidence. A mainstream scientist gains nothing by supporting an existing theory he knows to be wrong. He can make a big name for himself by proposing a viable alternative theory, and getting it accepted. How can you unequivocally claim that survival has not driven greater complexity? To survive a species does not have to be the best possible design, only a successful design. I am sure there many examples of species which survive for many generations in spite of being inferior to contemporary species. Even if single celled species are better at surviving that multi celled species, it does not guarantee that natural selection prevents the evolution of more complex organisms. Your GG theory postulates a deliberate design, implying a designer of life forms with a purpose. You are also postulating a creator for the universe. These are religious claims based on faith, not scientific claims based on evidence. You might believe that complexity is proof of purpose and a designer, but it is not. It is only an indication that complexity is a viable alternative to simple organisms.
I expect what I was talking about is complex design. Having thought about this issue of “irreducible complexity” I am currently of the opinion that it is not a very productive way to make the case for intelligent design. I support fully the argument for intelligent design but not always the way the argument is put. For example I can not see the benefit in arguing for irreducible complexity. It is very likely that all complex systems can trace their origins to simple (or irreducibly complex) systems. And it may also be true that there were no big jumps that can not be explained by the gradualists approach. Even if both these were true then I would still argue for there being a designer. But there must have been a jump from a non living system to a living system. We know that living systems can organize themselves and form complexity but before life there was nothing to do this. So before there were any living systems there had to be a non living system that had enough complexity to kick start life. Even now when we know the genetic code for life; and with intelligent designers and with many years of trying we have not got close to building a system that can create life. So the question is not whether complex systems can trace their origins back to non complex systems. The question is; how did that first system (that needed to be complex enough to kick start life) come into existence? Take the water (water being the only essential for life) out of both systems. A human being with no water and no life is still a system with order and complexity. It is probably little more than a skeleton but has many features that demonstrate intelligent design. Take the water out of the Grand Canyon and all you have is a very big hole in the ground and no evidence of intelligent design. Foot prints in the sand are the result of a designer. If you were alone on a desert island and one morning you woke up to find foot prints (not yours) in the sand would you assume no designer a priori; or would you assume you had a visitor? Would you tell a palaeontologist who finds the dinosaur footprints that he should first assume they were put there by accident? What about SETI (Search for Extra Terrestrial Intelligence)? If they find a string of non random signals from outer space are you going to argue that it was not a design but just an accident? If you did this then they would come back at you with exactly the same argument I have put forward; (i.e. what is the probability of it happening by accident?) And I am sure everyone will agree with them. But as sure as hell they will not agree with me.
No i don't think this is what they mean when they talk about time. They are not saying time never existed, they are saying time does not exist anymore. Therefore, we existed when time existed. Think of it like time is not "ticking" anymore. Just as if we were frozen in time and our clocks stopped running. Now get rid of all the matter, space and energy an u have what it will be like after the big crunch Please Register or Log in to view the hidden image! But surely u believe, that once the universe comes into existence, many different kinds will produce life eventually (although most will not).
Dinosaur: Maybe I should have been a little more specific here. Natural selection is obviously an important factor in determining how species evolve. My argument with the Darwinian paradigm is only that natural selection alone can not design complex systems. There argument is that it can. You would hope that this would be the case. Unfortunately however this does not appear to be how the system works. James Lovelock was an eminent scientist who proposed an alternative system but was hounded by the establishment and accused of advocating a teleological alternative. (Lovelock eventually retracted much of what he proposed in his “Gaian” theory.) Sir Fred Hoyle (and his supporters) later embraced the original Gaian concept and this was treated with outrage by the scientific community. So much so that even today Hoyle’s suggestion that life may have originated from outer space is referred to as “Hoyle’s howler”. Professor Ted Steele has been challenging the Weismann’s barrier for 25 years and has been dubbed by many as the “bad boy of biology”. Steele is something of a Maverick and does not appear to mind the controversy. In 2001 he was dismissed from Wollongong Univ. for going public about soft marking and most observers thought he would have been treated far less harshly if his scientific work was less radical. I tried very hard (for obvious reasons) to develop my concept on campus but was quickly shown the door whenever I revealed my anti Darwinian stance. Most mainstream scientists (who are involved in research) would appear to be more concerned about their careers and their mortgages and are reluctant to rock the boat. They might make a big name for themselves if they prove to be correct and can survive the many years of controversy that it is likely to take to have their views accepted. Many like John Likoudis (who suggested that peptic ulcers were caused by a bacteria (called H.pylori) was not vindicated until after his death. For more on John Likoudis see: http://www.abc.net.au/rn/science/ss/stories/s782213.htm This is totally contradictory to Darwinism. Darwinism holds that because more of any species is born than can possibly survive there will always be competition for resources. It is this competition that ensures only the best adapted will survive to pass on their genes to the next generation. The less well adapted will not survive to reproduce and their genes will be lost. As mentioned above, Darwinism holds that only the best adapted will survive. But that is not the main issue. Natural selection argues that enough mistakes in zipping up the genetic code (mutations) at conception will eventually lead to complex designs. Complex designs like the human brain or the eye. This is like saying that enough mistakes in programming a computer will lead to improvements in a computer program. Dinosaur you are a computer programmer. Do you believe that, with enough time and enough throws of the dice, a complex computer program could ever be written this way? Can you give me an example of any complex system that has come into existence by accident and not design? It seems that no matter how often I protest people will still accuse me of a religious or faith based philosophy. So how is my claim for a multiverse different than Sir Martin Rees? Rees is the British Astronomer Royal and argues that it is reasonable to postulate a theory that can never be proven true. He says by postulating the existence of other universes we can then present a model and see if this model is in conformity with other things we know to be true. And if such a model is more in conformity (than other models) with what we know to be true then this is a worthwhile scientific endeavour. Basically this is the only logical scientific process that will work when you are dealing with issues that can not be proven and in many cases are unlikely to ever be proven. As mentioned above complexity is not a viable Darwinian alternative. And a complex universe could no more come into existence by accident than complex living systems. So again; what is wrong with postulating a purpose? God Gametes merely points out that our universe has life. (This is true even if we are the only life in our universe.) Our universe had a start and will one day have a finish so it is cyclical. So everything that we know that has life and is cyclical has been produced by some living system and will inturn reproduce itself one day. Or to put it another way; if our universe is not the product of a living system, and its role is not to reproduce, then it is the only living (and cyclical) thing we know that does not conform to these universal truths. Is that not postulating a model that is in conformity with what we know to be true?
Robert_js: Pardon me for butting in here, but I'd like to respond to your post directed to Dinosaur. I thought the Gaia theory could be taken as illustrating Darwinism on a planetary scale, to the extent where the planet itself seems to behave like a kind of self-regulating organism. I admit, I don't know the details, but I don't think it would be too controversial. Hoyle's suggestion that life originated in outer space (the "panspermia" hypothesis) is fine, as far as it goes. But it doesn't resolve anything. It just pushes the question back a step. Where did the space life come from? Most observers? I disagree. That view is a kind of ultra-Darwinism. The actual theory says no such thing. Darwinian evolution is all about statistics - things which happen on average. It is by no means certain that if you take two organisms, one fitter than the other, that the fitter one will survive longer or leave more progeny. Darwinian reasoning only ever applies to large populations, and then it is an average effect. Computer programmes are not generally subjected to selection pressures. But where such pressures exist (e.g. in various computer virus environments and in certain systems which have the ability to produce variation), improvements of the kind you mention can and do happen. Why do you insist on constantly ignoring selection? Evolution is NOT random. You. The notion of a mysterious all-powerful "creator" is a religious one, wouldn't you say? In the case where the model produces testable effects, it would seem that it can be proven true after all, so Martin Rees seems to be having a foot on each side of the line. Selection. It's all about selection. Not randomness. What kind of finish do you envision? One which creates a cycle, obviously. Modern astrophysics seems to disagree with that hypothesis at present.
Robert JS: You should be more familiar with a theory before you try to knock it. Modern evolutionary theory does not state that only the fittest or best adapted survive. If it made such a claim, there would be a myriad of voices raised to point out the exceptions to such a claim. It only claims that natural selection gives an advantage to the better adapted. This implies (as strongly supported by the evidence) that over long periods of time, many (not all) of less adapted species will become extinct, while most (not all) of the better adapted will survive Once again, I repeat myself: One need not believe in a formal religion to be accused of having faith based beliefs. Your fundamental belief in a creator and a purpose for the universe is a faith based belief, analogous to but not equivalent to belief in a formal religion. If evolution bothers you, stay away from quantum theory. It describes a world governed by probability instead of causality. Among other outrageous claims, it states that a motionless particle has no position. It bothered the hell out of me until I was willing to give up some faith based beliefs, which I would not describe as religious. It was pointed out to me by those more knowledgeable than I that faith based beliefs prevented me from accepting various well supported aspects of quantum theory. Those pointing out my faith based view were well aware that I was an atheist. BTW: I assume that you are not an atheist.
I "believe" evolution is capable of designing complex systems. No human has ever grasped time scales of more than a hundred years. And as JamesR put it, it is not random, meaning that it goes in a certain direction in accordance with environmental pressures.
John Connellan Yes I agree with both of the above statements. But we were originally discussing how the laws of probability (and time) might somehow be different outside the parameters of our universe. I have no problem with the concept of time stopping ticking. I also have no problem with the fact that different types of life came into existence. Obviously they did or we would not be here. But the question we were trying to address was how did it happen. How did such a complex universe come into existence? You were trying to tell me that the probability of 1 : 10(-120) would not be relevant outside the parameters of our existence; (i.e. where the laws that govern our universe may not hold true). Please address this issue. Do not attempt to respond to my posts by simply throwing up points that are not in contention.
Dinosaur Dinosaur, I am familiar with the Darwinian theory. Or should I say I am familiar with the myriad of jumbled, confused and contradictory arguments that attempt to support a concept that is plainly wrong. You refer to “modern evolutionary theory” as if there were a united voice on this subject. I would say that there are many differing opinions with no one (including the God Gametes theory) being close to proven scientific fact. But to address the point you make about the less well adapted. Yes it is true that the less well adapted will sometimes survive. And I agree that some modern evolutionary theories recognise this point for it is plainly obvious that it is true. But it is fundamental to the Darwinian paradigm that the less well adapted do not survive. Darwinism holds that, because there are always more born than can possibly survive, only the best adapted will live to pass on their genes to the next generation. This is central to the Darwinian dogma. I know (as all observers know) that sometimes the less well adapted survive but this only serves to prove Darwinism incorrect. Darwinism is referred to as survival of the fittest. It is what (according to Darwinism) is driving complexity. If the less well adapted survive to pass on their genes then some other force must be at work. So Darwinists are having it both ways. They recognise that it is not always the fittest that survive but claim “survival of the fittest’ is the driving force of evolution. This is rather irritating. Would you say that Darwinism is a faith based belief? It can no more be proven than GG. I have not shied away from the word “God” but that does not mean my concept is “faith based” or a “religious” concept. My book attempts to bring together, on the one hand, our rapidly expanding body of scientific knowledge, and on the other, a meaning and a purpose for life. Scientific knowledge has raced ahead at breakneck speed into the 21st century while most religious philosophy remains shackled to doctrine that is hundreds, if not thousands, of years old. My aim in writing God Gametes has been to provide a framework in which the presence of a creator, and a purpose for life, are fully compatible with present day scientific know how. So what is wrong with suggesting that there might be a purpose for our being here. Do you think that the advances in science has improved the prospects of our species surviving? Do you think the captains of industry (and the politicians they have in their pockets) have identified a purpose for life; or could really give a damn about anything other than making money? Is it really a good thing that we are all taught that nothing created us and that there is no purpose for life? On the contrary, I found quantum theory very helpful to the GG concept. It suggests there are more dimensions to life than we are currently aware of and this is consistent with there being other universes and an external source of life. In particular quantum theory puts consciousness at the centre of our existence. GG argues that the purpose of life (and the reason we evolved complexity) is to host our consciousness. I will not discuss it here but if you download my book from www.godgametes.com (Chapter 1. sections on Faster-than-light Signalling and Speed of Light) it puts forward a reason why our universe allows nothing other than our human consciousness to travel faster than light. I do not know how quantum theory can possibly establish a more rational (or purely scientific) view of the world. I would have thought the opposite more likely. A Darwinian interpretation of life must have difficulty explaining why quantum particles react to human observation. I suppose I still call myself an agnostic. I believe there must be a creator but have no idea who or what that creator might be. GG argues that there is a purpose for life and that purpose is to reproduce our parent species. But I have no idea how this might help us live our lives or make our existence here on planet earth more meaningful. What about you Dinosaur? Do you believe there has been no purpose to your life and to life on earth? Not only do I find that irrational but I suspect it is the preferred option for many. Can you explain to me why people are so reluctant to attribute a meaning and purpose to life?
James R That is fine but what about responding to the last post I directed to you? In particular I addressed the issue of irreducible complexity but you never replied. You keep introducing issues like “falsifiability” and “irreducible complexity” and suggest that if something is not falsifiable or irreducibly complex then it is invalid. But neither is true. The statement that “there is an elephant in my refrigerator” is perfectly falsifiable. So if I said there was an elephant in my refrigerator, you opened the door to find no elephant, then my statement is falsifiable but completely untrue. And the issue of irreducible complexity can not establish the case (or disprove the case) for intelligent design. As argued in my above quote the issue of irreducible complexity is best addressed by asking how did that first life kick into place. Watson and Crick revealed the structure of DNA in 1953 but 50 years later (with the formula of life in hand) no one has successfully created life in the laboratory. My argument is that the jump from “no life” to “life” needed to benefit from a complex system. And the point here of course is that before there was life there could have been no Darwinian natural selection to design the first complex system that got life up and running. For the sake of the following I will assume you are correct when you argue that all matter was created in the big bang. I will also allow that there is a rational (scientific) reason for all the heat in stars and the gravitational forces that hold it all together. The only concession I ask is that the system that first got life started was not a simple 5 or 6 nucleotides (or electrical connections) as you argued in an earlier post. We do not know of any life form that can find its own food source (and reproduce itself) that is this simple. With the structure of DNA revealed over 50 years ago (and still not being able to create life in the laboratory) it is reasonable to speculate that this be a more complex system than you suggested earlier. So what sort of system might have got life started. Man has built massive computers and space shuttles but not a system that can create life. A gene that codes for a simple protein will normally have more than 1,000 base pairs but in this exercise we will allow for 70 base pairs (or 70 bases of A, C, T and G). But because the first system that created life could not have been driven by Darwinian natural selection then these 70 bases of A, C, T and G had to fall together by accident. The problem we now have is that we do not know what the magical formulae for life might have been and how difficult it would have been to hit upon by accident. Again I will make a concession. I will allow that could be any sequence that was non random. It does not have to make sense or code for anything as long as it is a sequence that is non random. And I suggest that the least difficult way of doing this is to type out 35 bases of A, C, T and G in any sequence; then calculate the probability of accidentally typing out the second 35 of A, C, T and G in the exact same sequence. For example -: ACGTGCTACTGATGACTGACCTGAGATCATCGGACTTGAC ACGGCATACTGCATGACGTGCATGATCGGTACATGCTCGA CTAGCTGAGACTGCATCACTATGCGATCCATGCATGGTCA The above is gibberish. It is ACTG copied out 35 times in a purely random sequence. To accidentally copy it out again in exactly the same sequence is a probability of 10(-21). The same probability of finding one grain of rice in a pile of rice that would take 1,000, 50 ton trucks, taking one load an hour, 24 hours a day, 365 days a year, 460,000 years to carry away. And that sequence is not the genetic code for life. It is just any sequence that is non random. Any other non random sequence (or any other sequence for creating life) would be just as improbable. Why do you insist on ignoring the point I make? I have said many times that natural selection is not random. It is the selection of the fittest and by definition is not random. But the zipping up of the genetic code at conception (the creation of new genes for new species) is said to be random. The evolution of a new design can not be attributed to natural selection. You can not select for a new design from a species that does not have that design. This falling into place of a new design must be attributed to a random process. Really James; is that the best you can do? So I am arguing that living systems need a designer and point out that non living (or man made) systems all have a designer. I ask if you can think of “any complex system that has come into existence by accident” and you give me a living system (me) as an example. Depends on how you define religion. Most (including myself) would see a religion as a movement of people who expect if they adhere to a doctrine (and sometimes a set of social values) will have their souls saved by an all powerful divine being. I am certainly not part of such a movement and the GG concept does not advocate a set of social values or suggest a way that people can save their souls. God Gametes merely suggests that something must have created life and our universe and puts forward a model that might give a reason for why it happened. That is all. But it appears that the scientific community can not accommodate this type of concept. How disappointing! I do not see it that way. If a model produces testable effects then that is fine. Some models however will never produce testable effects. But it still may be a worthwhile exercise to postulate a theory (and test it against what we know to be true) even if that theory can never be proven true or false. Any living system that has a start and a finish is cyclical. Even if all the stars just burn out and there is no big crunch then it is still cyclical.
No one is willing to have a go at my post re “intelligent design” but I have decided to write again. I started this thread with a post that questioned the conventional theories on human migration. My argument being that it would have been impossible for our early ancestors to have migrated to all parts of the world. The suggestion that they crossed the Atlantic (and made it to places like Australia and New Zealand) in primitive wooden craft is quite ridiculous. I also made the point that some palaeontologists believe it was likely an earlier ancestor of modern man who migrated out of Africa. If this were the case then it would have been impossible (in Darwinian terms) for a different species to have migrated to many places of different climatic and environmental regions but then to have all evolved into one species of modern man. This is the opposite of what would be predicted by Darwinism. The different climatic and environmental conditions should have driven the evolution of many different species. But for all the diverse regions to have evolved an earlier species into the same species of modern man is contrary to the way that Darwinism suggests species evolve. Equally unlikely is the prospect that many different species evolved but only one survived to then quickly inhabit the entire globe. If this is what happened it would be unlikely that modern man would have so many racial differences that suggest adaptation to regional environmental conditions. Most of the responses to my earlier posts pointed out that the “Out of Africa” theory argues that it was modern man that migrated out of Africa about 150,000 years ago; not an earlier ancestral species to modern man. So how does this “Out of Africa” theory accommodate the recent finds of homo floresiensis? Flores Man lived until about 12,000 years ago on an island between Bali and Timor (Indonesia) and was only about 3 feet high. This species was an isolated offshoot to our species with a brain about one quarter the size of homo sapiens. But Flores Man lit fires, made stone tools and organised themselves into groups for hunting meat. It would seem that Flores Man has placed the final nail in the coffin of the Out of Africa theory. The options are these -: Many ancestral species migrated out of Africa but all died out except one. Many ancestral species migrated out of Africa but all evolved into one species of modern man. Or many different species of modern man evolved in separate regions with all dieing out except one. None of these options makes any sense in terms of the Darwinian paradigm.
